Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • dvanic
    Member
    • Jan 2012
    • 61

    #1

    Trimmomatic error

    Hi! I'm trying to run trimmomatic, and running into the following error:

    My input:
    java -classpath $BIN/trimmomatic/Trimmomatic-0.20/trimmomatic-0.20.jar org.usadellab.trimmomatic.TrimmomaticPE -phred33 9_1.fastq 9_2.fastq 9_1.fastq_PAIRED_1 9_1.fastq_UNPAIRED_1 9_2.fastq_PAIRED_2 9_2.fastq_UNPAIRED_2 ILLUMINACLIP:contaminants.fa:2:40:15 LEADING:3 TRAILING:3 SLIDINGWINDOW:5:15 MINLEN:36
    And the output:
    Exception in thread "main" java.lang.NegativeArraySizeException
    at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.packSeq(IlluminaClippingTrimmer.java:578)
    at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer$IlluminaClippingSeq.<init>(IlluminaClippingTrimmer.java:548)
    at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer$IlluminaClippingSeq.<init>(IlluminaClippingTrimmer.java:538)
    at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.mapClippingSet(IlluminaClippingTrimmer.java:125)
    at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:111)
    at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.<init>(IlluminaClippingTrimmer.java:43)
    at org.usadellab.trimmomatic.fastq.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:26)
    at org.usadellab.trimmomatic.TrimmomaticPE.main(TrimmomaticPE.java:335)
    How do I fix this????
    Thanks in advance!
  • dvanic
    Member
    • Jan 2012
    • 61

    #2
    Have tried this on another server, with another datafile, from the trimmomatic directory itself. Still not working

    Comment

    • westerman
      Rick Westerman
      • Jun 2008
      • 1104

      #3
      Looks like a good command line. As as guess I am going to say that your input files have a different quality score than 'phred33'. Part of this guess is the 'negative array' message. Try with 'phred64' (or nothing, should default to phred64.

      Comment

      • dvanic
        Member
        • Jan 2012
        • 61

        #4
        Exception in thread "main" java.lang.NegativeArraySizeException
        at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.packSeq(IlluminaClippingTrimmer.java:578)
        at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer$IlluminaClippingSeq.<init>(IlluminaClippingTrimmer.java:548)
        at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer$IlluminaClippingSeq.<init>(IlluminaClippingTrimmer.java:538)
        at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.mapClippingSet(IlluminaClippingTrimmer.java:125)
        at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:111)
        at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.<init>(IlluminaClippingTrimmer.java:43)
        at org.usadellab.trimmomatic.fastq.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:26)
        at org.usadellab.trimmomatic.TrimmomaticPE.main(TrimmomaticPE.java:335)
        Same thing, I'm afraid. And the quality scores are from Casava 1.8.2, so I know for a fact they're Phred+33 (or, more accurately they've got J's in them as well, so they're in the (0,41) range). For example:
        @ILLUMINA:2430TC9ACXX:1:1101:1470:2047 1:N:0:ACAGTG
        NAGTTATTTGCCTCTTTGAAGCGTTTTCCAACAGTATAGATCTCATGAATCAAATCCTCCATGCAGATGATGCCGNATTNNCCAAGAGATCGAGCAATCAA
        +
        #1=DDFFFHHHHHJJJJJJIJIJIJJJIHIJJJJIJJJJIJJJJIJJJJJJJJJJJIIJHIJJFIIIJIJJJIJH#-;B##,,=ADDDDCDDDDBDDDCDD
        @ILLUMINA:2430TC9ACXX:1:1101:1500:2115 1:N:0:ACAGTG
        CGCCATACAGCAGGAATGGGAGCTGCCCCCCTGGGCACAGCTTCTGCACTGTCTCGGTCCGCCTTTTGGTGTCAACGGTGGTAACATTGAAGGTGACTCCC
        +
        CCCFFFFEHHFFFGBBHIJIEFHIIGGIJJGI?FHFGIJGIIJE@;FGHGIHGIHHG;B?>CCDBDC58,89>55:;<2295>C@>CC@@CC?3:44>4@?
        @ILLUMINA:2430TC9ACXX:1:1101:1401:2131 1:N:0:ACAGTG
        CTGGACTTGCTGGCTTCCCTGAAACGGAGAGAGCGAGAGGAGAAGGACGATGGGGAGGACAAGAAGAAGTCCAAAGTCTCCTCCTACAAGGACTGGGAAGA
        +
        @CCFDEFFHHHHHHIJGIJJJGIJIHJ?E@F@F9FAD@FGBGBCFGACG@CHHHF?BD;=?AB?AA>AA>>CCDC<:4>@C@CC?ACDC@ABBDDDD<>@8
        I wonder, actually, if it's the extra "J" that could be the problem...

        Comment

        • arvid
          Senior Member
          • Jul 2011
          • 156

          #5
          Phred scores should allow 0,93. In any case, following the stack trace, I would bet that it has problems with your contaminants.fa file. How does that file look like?

          Comment

          • tonybolger
            Senior Member
            • Feb 2010
            • 156

            #6
            Originally posted by dvanic View Post
            Same thing, I'm afraid. And the quality scores are from Casava 1.8.2, so I know for a fact they're Phred+33 (or, more accurately they've got J's in them as well, so they're in the (0,41) range). For example:

            I wonder, actually, if it's the extra "J" that could be the problem...
            Sorry i haven't been around this forum for a while and missed this thread.

            Arvid is likely correct - the problem looks like its caused by very short sequences in the adapter fasta (<16 bases).

            While short adapter sequences are usually not a good idea anyway (since they will likely have a high false positive rate and match good data), the latest Trimmomatic version, 0.22, should resolve this problem. I've just uploaded it to the website.

            Comment

            • dvanic
              Member
              • Jan 2012
              • 61

              #7
              Thanks. My contaminants.fasta has only the standard illumina PE adapters, so nothing is shorter than 16 bases:
              >adapter1
              GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
              >adapter2
              ACACTCTTTCCCTACACGACGCTCTTCCGATCT
              >PCRPrimer1
              AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
              >PRCPrimer2
              CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
              >GenomicDNASequencingPrimer
              ACACTCTTTCCCTACACGACGCTCTTCCGATCT
              >PEAdapter1
              >GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
              >PEAdapter2
              ACACTCTTTCCCTACACGACGCTCTTCCGATCT
              >PEPCRPrimers1
              AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
              >PEprimers2
              CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
              >PESequencingPrimer
              ACACTCTTTCCCTACACGACGCTCTTCCGATCT
              >PESeqprimer2
              GGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
              However, thank you!!!

              I've tried running Trimmomatic 0.22, and it works, with the same contaminants.fa, no more errors, on our server.

              Comment

              • billstevens
                Senior Member
                • Mar 2012
                • 120

                #8
                Hi guys, I had a question about Trimmomatic and trimming in general. Is the standard to trim bases below Phred Score 20, more or less? I have 100 bp PE reads, and the average of each base quality is over 30, but the first 5 bases are around 31 while after that it rises to an average of 35. I am using an Illumina HiSeq 1000. So is the way to go about this to use Trimmomatic with Sliding Window size of 1 and Phred Scores of 20? When I ran it without any trimming, I got 90% mapped reads, but I'm worried that since I didn't trim, I had a lot of mismatched assemblies. What do you guys think? Any recommendations?

                Comment

                • westerman
                  Rick Westerman
                  • Jun 2008
                  • 1104

                  #9
                  More or less, yes. Some programs work very well without trimming and there are arguments for not doing so -- takes extra time and disk space which could be used for the mapping process instead. Your sequences sound like they have very good quality so there is probably no overriding need to trim them. Personally I just chop off the 5' and 3' ends that don't match the q20 limit. Internal poor quality is something that does not worry me.

                  Comment

                  • billstevens
                    Senior Member
                    • Mar 2012
                    • 120

                    #10
                    Thanks Rick! I was thinking it was fine, and last time I trimmed the first 5 bases, it just took forever. So would you still recommend that I use Trimmomatic to trim the ends based on quality score lower than 20 for the few reads that do have that? Or since the averages are over 30, is not really necessary? Cause like you mentioned, it really does take a lot of time...

                    Comment

                    • westerman
                      Rick Westerman
                      • Jun 2008
                      • 1104

                      #11
                      It is your data but from my plant and animal background where 90% is something to die for ... I say no trimming is needed. You have good data!

                      Comment

                      • tonybolger
                        Senior Member
                        • Feb 2010
                        • 156

                        #12
                        Originally posted by billstevens View Post
                        Thanks Rick! I was thinking it was fine, and last time I trimmed the first 5 bases, it just took forever. So would you still recommend that I use Trimmomatic to trim the ends based on quality score lower than 20 for the few reads that do have that? Or since the averages are over 30, is not really necessary? Cause like you mentioned, it really does take a lot of time...
                        Quality trimming is not so critical for alignment, especially for quality-aware aligners. I'd still recommend adapter trimming though, since even a moderate read-through (say 10bp) can cause the read to be lost. And with 100bp, you can easily afford to cut of 30-40bp of adapter, and still map uniquely (most of the time). Then again, at 90% mapping, you're probably golden either way - i like mining data closer to the limit on principle though.

                        As for lack of performance, have you tried multi-threading? Trimmomatic throughput should scale until the bottleneck is either disk IO or (un-)zipping of the input/output on most machines.

                        Comment

                        • mparida
                          Member
                          • Mar 2012
                          • 15

                          #13
                          I tried using the new trimmomatic and foudnthie error
                          java -classpath trimmomatic-0.22.jar org.usadellab.trimmomatic.TrimmomaticPE -phred64 ~/Oiko_otogenetics/index45_TCATTC_L001_R1_001.fastq ~/Oiko_otogenetics/index45_TCATTC_L001_R2_001.fastq ~/Oiko_otogenetics/index45_TCATTC_L001_R1.fastq_PAIRED_1 ~/Oiko_otogenetics/index45_TCATTC_L001_R1.fastq_UNPAIRED_1 ~/Oiko_otogenetics/index45_TCATTC_L001_R2_001.fastq_PAIRED_2 ~/Oiko_otogenetics/index45_TCATTC_L001_R2_001.fastq_UNPAIRED_2 ILLUMINACLIP:~/Oiko_otogenetics/contaminants.txt:2:40:15 LEADING:15 TRAILING:15 SLIDINGWINDOW:5:18 MINLEN:36
                          TrimmomaticPE: Started with arguments: -phred64 /Users/mparida/Oiko_otogenetics/index45_TCATTC_L001_R1_001.fastq /Users/mparida/Oiko_otogenetics/index45_TCATTC_L001_R2_001.fastq /Users/mparida/Oiko_otogenetics/index45_TCATTC_L001_R1.fastq_PAIRED_1 /Users/mparida/Oiko_otogenetics/index45_TCATTC_L001_R1.fastq_UNPAIRED_1 /Users/mparida/Oiko_otogenetics/index45_TCATTC_L001_R2_001.fastq_PAIRED_2 /Users/mparida/Oiko_otogenetics/index45_TCATTC_L001_R2_001.fastq_UNPAIRED_2 ILLUMINACLIP:~/Oiko_otogenetics/contaminants.txt:2:40:15 LEADING:15 TRAILING:15 SLIDINGWINDOW:5:18 MINLEN:36
                          Exception in thread "main" java.io.FileNotFoundException: ~/Oiko_otogenetics/contaminants.txt (No such file or directory)
                          at java.io.FileInputStream.open(Native Method)
                          at java.io.FileInputStream.<init>(FileInputStream.java:106)
                          at org.usadellab.trimmomatic.fasta.FastaParser.parse(FastaParser.java:55)
                          at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:68)
                          at org.usadellab.trimmomatic.fastq.trim.IlluminaClippingTrimmer.<init>(IlluminaClippingTrimmer.java:45)
                          at org.usadellab.trimmomatic.fastq.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:29)
                          at org.usadellab.trimmomatic.TrimmomaticPE.main(TrimmomaticPE.java:335)
                          This is what my contaminants file looks like:
                          >Illumina_Paired_End_Adapter_1
                          ACACTCTTTCCCTACACGACGCTCTTCCGATCT
                          >Illumina_Paired_End_Adapter_2
                          CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
                          >Illumina_Paried_End_PCR_Primer_1
                          AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
                          >Illumina_Paired_End_PCR_Primer_2
                          CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
                          >Illumina_Paried_End_Sequencing_Primer_1
                          ACACTCTTTCCCTACACGACGCTCTTCCGATCT
                          >Illumina_Paired_End_Sequencing_Primer_2
                          CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT
                          What do I do???? Please help

                          Comment

                          • mparida
                            Member
                            • Mar 2012
                            • 15

                            #14
                            I tried moving the contaminants file to the dir Trimmomatic-0.22/ and it is working. Thanks.

                            Comment

                            • westerman
                              Rick Westerman
                              • Jun 2008
                              • 1104

                              #15
                              I think the problem is not specifying a complete path. Using '~' as a short-cut to your home directory does not work with all programs.

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 08-13-2026, 12:22 PM
                              0 responses
                              29 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-11-2026, 10:35 AM
                              0 responses
                              24 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-06-2026, 07:41 AM
                              0 responses
                              38 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-03-2026, 10:13 AM
                              0 responses
                              51 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...