Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • mslider
    Junior Member
    • Sep 2010
    • 25

    #31
    yes i have made adapters file myself because i have not find the best file corresponding to ScripSeq-v2 protocol in trimmomatic manual, in ScripSeq-v2 protocol it was mentionned this adapter:

    5' CAAGCAGAAGACGGCATACGAGAT index (NNNNNN) GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3'

    and in my read 1 you find the reverse as:
    GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG

    i don't know if TruSeq3-PE-2.fa adapter file was the good option to clean my PE reads.

    Comment

    • a.vhd
      Junior Member
      • Apr 2015
      • 5

      #32
      Hi all, I have tried Trimmomatic using the following command line:
      java -jar trimmomatic-0.33.jar PE OrAe0G_read1.fastq OrAe0G_read2.fastq OrAe0G_read1_pe.fastq OrAe0G_read1_se.fastq OrAe0G_read2_pe.fastq OrAe0G_read2_se.fastq HEADCROP:13 TRAILING:5 ILLUMINACLIP:TruSeq2-PE.fa:2:30:10 MINLEN:20
      and running in to the following error:
      Caused by: java.lang.ArrayIndexOutOfBoundsException: 58
      at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer$IlluminaPrefix
      Caused by: java.util.concurrent.ExecutionException: java.lang.ArrayIndexOutOfBoundsException: 58
      at java.util.concurrent.FutureTask.report(FutureTask.java:122)
      at java.util.concurrent.FutureTask.get(FutureTask.java:192)
      at org.usadellab.trimmomatic.threading.TrimStatsWorker.run(TrimStatsWork
      Thanks alot,

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      18 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      18 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      25 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      38 views
      0 reactions
      Last Post SEQadmin2  
      Working...