Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • iceice
    Junior Member
    • May 2012
    • 4

    Quake!!!!!!!!!!!!!!

    After struggleing with the first two step of quake for one day, finally started the 3rd step, but got the following message:

    cmd:

    correct -f R1_renamed.fastq R2_renamed.fastq -k 15 -c 3.76 -m R.qcts -p 1 -q 33

    Result:

    8907980 trusted kmers
    AT% = 0.344978
    @DJDP4KN1:1:1101:10000:102173#TGACCA/1
    CCAGCAGGAAGAGCTTGCCGCGTGCGGTGGGGTCGAGGTGGGTGGCGTATTCGAGGTGGTGTTTTTCCATCACCAGGATGATGTCGGCCCAGCGGCTGAT
    +
    terminate called after throwing an instance of 'std:ut_of_range'
    what(): basic_string::substr
    Aborted



    Any tips?

    Binbin
  • bryand
    Junior Member
    • Aug 2010
    • 9

    #2
    Check the offending record in your fastq file and see if there's something weird about the quality line?

    Comment

    • iceice
      Junior Member
      • May 2012
      • 4

      #3
      That is the first sequence in the fastq file, could not find anything wrong:

      head R1_renamed.fastq
      @DJDP4KN1:1:1101:10000:102173#TGACCA/1
      CCAGCAGGAAGAGCTTGCCGCGTGCGGTGGGGTCGAGGTGGGTGGCGTATTCGAGGTGGTGTTTTTCCATCACCAGGATGATGTCGGCCCAGCGGCTGAT
      +
      CCCFFDFFHHHHHJJJJJJJJJHJIJJGHIJJHIJ<EH9BED=@BDD=BDDEDDDD7AB5?8@DDDDDDEDDDDDBDDDDDEDEDDDDDDDDCDDDDDAC

      Any tips?

      Comment

      • bryand
        Junior Member
        • Aug 2010
        • 9

        #4
        I'd say it's because your quality score length is not as long as your sequence length. That means that quake will be trying to use the newline character as a quality score, which is out of the range of the quality score. Either find out why your sequence file is corrupted, or pad the end of the quality sequence with low quality scores.

        Good luck!

        Comment

        • gaffa
          Member
          • Oct 2010
          • 82

          #5
          Originally posted by bryand View Post
          I'd say it's because your quality score length is not as long as your sequence length. That means that quake will be trying to use the newline character as a quality score, which is out of the range of the quality score. Either find out why your sequence file is corrupted, or pad the end of the quality sequence with low quality scores.

          Good luck!
          Actually they are of equal length, it's just that the forum font is not monospaced.

          Comment

          • bryand
            Junior Member
            • Aug 2010
            • 9

            #6
            Ok, how about this: Your quality scores don't correspond to the phred base that you specify? The ascii value of J is 74, and 74 - 33 = 41. I don't know how quake is evaluating the quality scores, but try lowering every quality score by 10 or so in that record and see if that fixes the problem (or at least reduce the J score).

            Comment

            • iceice
              Junior Member
              • May 2012
              • 4

              #7
              Originally posted by bryand View Post
              Ok, how about this: Your quality scores don't correspond to the phred base that you specify? The ascii value of J is 74, and 74 - 33 = 41. I don't know how quake is evaluating the quality scores, but try lowering every quality score by 10 or so in that record and see if that fixes the problem (or at least reduce the J score).
              But why subtract 10? And how to implement?

              Comment

              • bryand
                Junior Member
                • Aug 2010
                • 9

                #8
                I said 10 just to test your data and see if that's the case (in case any other of your characters are above ascii score of 40). You can pretty easily change just the H and J from the command line:

                perl -n -e 'tr/HIJ/EFG/; print;' fastq_to_check.fq > new.fq

                Again, try it just with this one fastq entry, otherwise you're going to parse your whole illumina file.

                Comment

                • iceice
                  Junior Member
                  • May 2012
                  • 4

                  #9
                  Do you mean Quake does not use quality score greater than 40? Could not see any useful info from the manual.

                  Comment

                  • bryand
                    Junior Member
                    • Aug 2010
                    • 9

                    #10
                    I'm not an author of the program, so I don't know - I've simply used it a couple of times and trying to guess as to what might in the end be causing your problem. I'd suggest you contact the authors directly and get their opinion if you can't solve it (assuming you don't want to go into the source code and figure it out for yourself)...

                    Comment

                    Latest Articles

                    Collapse

                    • mylaser
                      Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                      by mylaser
                      Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                      If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                      This guide explains everything you need to know about...
                      Yesterday, 01:13 AM
                    • SEQadmin2
                      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                      by SEQadmin2



                      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                      ...
                      07-09-2026, 11:10 AM
                    • SEQadmin2
                      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                      by SEQadmin2



                      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                      07-08-2026, 05:17 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, 07-09-2026, 10:04 AM
                    0 responses
                    19 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-08-2026, 10:08 AM
                    0 responses
                    11 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-07-2026, 11:05 AM
                    0 responses
                    26 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-02-2026, 11:08 AM
                    0 responses
                    31 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...