Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • DrMTB
    Junior Member
    • Jun 2012
    • 3

    Fastx-Toolkit Newbie help IUB codes in fastq causing error

    I simply wanted to try out a few command line alignments of ABI sanger sequences. I converted the .phd.1 files to fastq using a BioPerl script (http://www.bioperl.org/wiki/HOWTO:SeqIO). Then I wanted to trim these files according to the quality scores and so have been using the fastx-toolkit. Problem was the fastq nucleotide sequence gave an error ('found invalid nucleotide sequence') using any of the tools.
    Using a test file as follows was OK:
    @test
    GTGCGGTGGTGGAGACGCACTTGATAGTCCTTCTCCGCAGGTACTTT
    +
    &$"'&&$&&&""+)(&(*,213+)*),,/4:=2-,&",.1.9-7884

    But replacing any base with an IUB code gave the error again.

    Eg using (see R at position 5):
    @test
    GTGCRGTGGTGGAGACGCACTTGATAGTCCTTCTCCGCAGGTACTTT
    +
    &$"'&&$&&&""+)(&(*,213+)*),,/4:=2-,&",.1.9-7884

    $ fastx_quality_stats -i test.fastq -o test.stats -Q33
    fastx_quality_stats: found invalid nucleotide sequence (GTGCRGTGGTGGAGACGCACTTGATAGTCCTTCTCCGCAGGTACTTT) on line 2

    This must be the cause of the error - but why? Fastq files can have IUB codes surely!?
    Thanks for any help on this apparently simple question.

    Using :
    Ubuntu
    FASTX Toolkit 0.0.13.1
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    IUPAC ambiguity codes are valid in FASTQ, but typically you'll only see N (and ACGT). It seems that FASTX doesn't like this - you could report it.

    Comment

    • DrMTB
      Junior Member
      • Jun 2012
      • 3

      #3
      Thanks maubp
      Reply from Fastx-toolkit author says that these tools were designed to work with files from Illumina machines containing only ACGT & N and will therefore fail on other kinds of input.
      So that's that.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Yesterday, 12:17 PM
      0 responses
      13 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      12 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      37 views
      0 reactions
      Last Post SEQadmin2  
      Working...