Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How to do with unproperly mapped pe reads?

    Hi, I am a newbie in genome resequencing analysis. When I tried to use picard SortSam to sort pe reads, I found some reads are mapped in different chrosomes. How do you do with this case? Should I remove all such reads before sorting? What analysis can I do to these pe reads? Thank you for your help.

    FCC0A5LACXX:2:1101:1873:2244#ACAGTGAT 81 Gm16 6378912 37 90M Gm02 37092849 0 TACGCCTTTGAGCACGTATAGATCCTTTGATTATGTCTCGCCGAAAATCCGATTGTTGGGAATAACGTATTAAAGCCAATTCATTTTTTT @9@A?@>>BAC>DDCDCC>:<?DC@>C@CCC=A9>8GHEHIHCIJIGGGDHHGIGEEGAGGHFGHEIIJIJJJIIHHFDDDADDF@<@ RG:Z:CA109.1 XT:A:U NM:i:2 SM:i:37 AM:i:23 X0:i:1 X1:i:0 XM:i:2 XO:i:0XG:i:0 MD:Z:42A7A39
    FCC0A5LACXX:2:1101:1873:2244#ACAGTGAT 161 Gm02 37092849 23 90M Gm16 6378912 0 ATATTTTTAGTTATTATCAATGAAGGTAATAGAATATATTTTCTAAGAATGGATTGGGTTATTAATAAAATACCTCTTATTACTTGAGCA @@@FFFFFFHDDHIJJJCHIHEIIHI@@CGGGIEHGGHGIIJGHIGGEGIFEEGIEHHGHGGHJDHIIGIHIIGG:FGGIGDHGEHHDFC RG:Z:CA109.1 XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:1 XM:i:0 XO:i:0XG:i:0 MD:Z:90 XA:Z:Gm18,-37309287,90M,1;

  • #2
    I would not necessarily remove them. If there is more evidence (more read pairs) aligned in that way, you could look at chromosomal breaks/fusions which are quite common in cancer tissues.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Exploring the Dynamics of the Tumor Microenvironment
      by seqadmin




      The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
      07-08-2024, 03:19 PM
    • seqadmin
      Exploring Human Diversity Through Large-Scale Omics
      by seqadmin


      In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
      06-25-2024, 06:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Yesterday, 11:09 AM
    0 responses
    18 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-19-2024, 07:20 AM
    0 responses
    148 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-16-2024, 05:49 AM
    0 responses
    124 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-15-2024, 06:53 AM
    0 responses
    111 views
    0 likes
    Last Post seqadmin  
    Working...
    X