[jshaik]

Easiest way to fix this is to use seqret in emboss. Just convert the fasta file to ncbi style fasta and it automatically fixes the issue.

[jmarshall]

$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
[fai_build_core] different line length in sequence 'scaffold_28'.

The problem with scaffold_28 in this file was the same problem that was reported here. It has now been fixed, and the fix will appear in samtools (and htslib) 1.3.

[skbrimer]

Just for anyone interested here is the Biopython equivalent:

from Bio import SeqIO
SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")

The convert function returns the number of records if you wanted that information.

Thank you for this. Just ran into this problem.

[NRP]

I had the same sort of segmentation fault. There were no blank lines in my file though. It was apparently due to one of my sequences being >65535 bp (though I don't know why that should matter).

Maubp's biopython code took care of it nicely. Thanks!

[maubp]

Ah - blank lines at the end of the file can be easily overlooked.

In principle I believe that faidx can cope with blank lines *between* records, but I haven't made time to work out the required code changes to do this. It would probably save some general aggravation though

[jdjax]

For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.

It actually was blank lines. There were two blank lines at the end of my file that caused the problem.

[maubp]

Figured it out on my own.

For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.

[jdjax]

Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

I then looked at my fasta file in vim and it does not have any blank lines in the file.

Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

Thank you in advance for your help.

Figured it out on my own.

[jdjax]

The problem is that your FASTA file has a blank lines in it.
you need to get rid of them!!!

you can :g/^$/d in vi/vim editor.

Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

I then looked at my fasta file in vim and it does not have any blank lines in the file.

Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

Thank you in advance for your help.

[michmich]

The problem is that your FASTA file has a blank lines in it.
you need to get rid of them!!!

you can :g/^$/d in vi/vim editor.

[ardmore]

Hello, I have the same problem. I found the last lines in fa file likes:

ggttagggtgtggtgtgtgggtgtgtgtgggtgtggtgtgtgtgggtgtg
gtgtgtgggtgtgggtgtgggtgtgggtgtgtgggtgtggtgtgtgggtg
tggT

That means the last line has not the same length with others.
My question is that can I manually modify instead of using a software.
I don't want to install too many software because of rare usage.

Thanks.

[shinout]

I faced the same problem, but solved with webbrewer's code!

This bioperl snippet fixes the fasta:

use Bio::SeqIO;
$in  = Bio::SeqIO->new(-file => "inputfilename",
                       -format => 'Fasta');
$out = Bio::SeqIO->new(-file => ">outputfilename",
                       -format => 'Fasta');
while ( my $seq = $in->next_seq() ) {$out->write_seq($seq); }

Thanks a lot!

[maubp]

This bioperl snippet fixes the fasta

Just for anyone interested here is the Biopython equivalent:

from Bio import SeqIO
SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")

The convert function returns the number of records if you wanted that information.

[lindseyjane]

Thanks very much webbrewer for your bioperl fix, it worked perfectly.

[maubp]

populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
[fai_build_core] different line length in sequence 'scaffold_28'.
Segmentation fault

What's the meaning of defferent line length ?

I just found the same thing when there are blank lines in the FASTA file. The message "different line length" is very misleading in this case. I'll report this bug.