Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • jshaik
    replied
    Easiest way to fix this is to use seqret in emboss. Just convert the fasta file to ncbi style fasta and it automatically fixes the issue.

    Leave a comment:


  • jmarshall
    replied
    Originally posted by baohua100 View Post
    $ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
    [fai_build_core] different line length in sequence 'scaffold_28'.
    The problem with scaffold_28 in this file was the same problem that was reported here. It has now been fixed, and the fix will appear in samtools (and htslib) 1.3.

    Leave a comment:


  • skbrimer
    replied
    Originally posted by maubp View Post
    Just for anyone interested here is the Biopython equivalent:

    Code:
    from Bio import SeqIO
    SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")
    The convert function returns the number of records if you wanted that information.
    Thank you for this. Just ran into this problem.

    Leave a comment:


  • NRP
    replied
    I had the same sort of segmentation fault. There were no blank lines in my file though. It was apparently due to one of my sequences being >65535 bp (though I don't know why that should matter).

    Maubp's biopython code took care of it nicely. Thanks!

    Leave a comment:


  • maubp
    replied
    Ah - blank lines at the end of the file can be easily overlooked.

    In principle I believe that faidx can cope with blank lines *between* records, but I haven't made time to work out the required code changes to do this. It would probably save some general aggravation though

    Leave a comment:


  • jdjax
    replied
    Originally posted by maubp View Post
    For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.
    It actually was blank lines. There were two blank lines at the end of my file that caused the problem.

    Leave a comment:


  • maubp
    replied
    Originally posted by jdjax View Post
    Figured it out on my own.
    For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.

    Leave a comment:


  • jdjax
    replied
    Originally posted by jdjax View Post
    Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

    I then looked at my fasta file in vim and it does not have any blank lines in the file.

    Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

    Thank you in advance for your help.
    Figured it out on my own.

    Leave a comment:


  • jdjax
    replied
    Originally posted by michmich View Post
    The problem is that your FASTA file has a blank lines in it.
    you need to get rid of them!!!

    you can :g/^$/d in vi/vim editor.
    Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

    I then looked at my fasta file in vim and it does not have any blank lines in the file.

    Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

    Thank you in advance for your help.

    Leave a comment:


  • michmich
    replied
    The problem is that your FASTA file has a blank lines in it.
    you need to get rid of them!!!

    you can :g/^$/d in vi/vim editor.

    Leave a comment:


  • ardmore
    replied
    Hello, I have the same problem. I found the last lines in fa file likes:
    Code:
    ggttagggtgtggtgtgtgggtgtgtgtgggtgtggtgtgtgtgggtgtg
    gtgtgtgggtgtgggtgtgggtgtgggtgtgtgggtgtggtgtgtgggtg
    tggT
    That means the last line has not the same length with others.
    My question is that can I manually modify instead of using a software.
    I don't want to install too many software because of rare usage.

    Thanks.

    Leave a comment:


  • shinout
    replied
    I faced the same problem, but solved with webbrewer's code!

    Originally posted by webbrewer View Post
    This bioperl snippet fixes the fasta:

    Code:
    use Bio::SeqIO;
    $in  = Bio::SeqIO->new(-file => "inputfilename",
                           -format => 'Fasta');
    $out = Bio::SeqIO->new(-file => ">outputfilename",
                           -format => 'Fasta');
    while ( my $seq = $in->next_seq() ) {$out->write_seq($seq); }
    Thanks a lot!

    Leave a comment:


  • maubp
    replied
    Originally posted by webbrewer View Post
    This bioperl snippet fixes the fasta
    Just for anyone interested here is the Biopython equivalent:

    Code:
    from Bio import SeqIO
    SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")
    The convert function returns the number of records if you wanted that information.

    Leave a comment:


  • lindseyjane
    replied
    Thanks very much webbrewer for your bioperl fix, it worked perfectly.

    Leave a comment:


  • maubp
    replied
    Originally posted by baohua100 View Post
    populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
    [fai_build_core] different line length in sequence 'scaffold_28'.
    Segmentation fault

    What's the meaning of defferent line length ?
    I just found the same thing when there are blank lines in the FASTA file. The message "different line length" is very misleading in this case. I'll report this bug.

    Leave a comment:

Latest Articles

Collapse

  • seqadmin
    Recent Developments in Metagenomics
    by seqadmin





    Metagenomics has improved the way researchers study microorganisms across diverse environments. Historically, studying microorganisms relied on culturing them in the lab, a method that limits the investigation of many species since most are unculturable1. Metagenomics overcomes these issues by allowing the study of microorganisms regardless of their ability to be cultured or the environments they inhabit. Over time, the field has evolved, especially with the advent...
    09-23-2024, 06:35 AM
  • seqadmin
    Understanding Genetic Influence on Infectious Disease
    by seqadmin




    During the COVID-19 pandemic, scientists observed that while some individuals experienced severe illness when infected with SARS-CoV-2, others were barely affected. These disparities left researchers and clinicians wondering what causes the wide variations in response to viral infections and what role genetics plays.

    Jean-Laurent Casanova, M.D., Ph.D., Professor at Rockefeller University, is a leading expert in this crossover between genetics and infectious...
    09-09-2024, 10:59 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 10-02-2024, 04:51 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 10-01-2024, 07:10 AM
0 responses
21 views
0 likes
Last Post seqadmin  
Started by seqadmin, 09-30-2024, 08:33 AM
0 responses
25 views
0 likes
Last Post seqadmin  
Started by seqadmin, 09-26-2024, 12:57 PM
0 responses
18 views
0 likes
Last Post seqadmin  
Working...
X