Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • samtools faidx Segmentation fault

    populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
    [fai_build_core] different line length in sequence 'scaffold_28'.
    Segmentation fault

    What's the meaning of defferent line length ?

    It's the standard fasta file.

    I download it from:
    ftp://ftp.jgi-psf.org/pub/JGI_data/P...asked.fasta.gz

  • #2
    Originally posted by baohua100 View Post
    populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
    [fai_build_core] different line length in sequence 'scaffold_28'.
    Segmentation fault

    What's the meaning of defferent line length ?

    It's the standard fasta file.

    I download it from:
    ftp://ftp.jgi-psf.org/pub/JGI_data/P...asked.fasta.gz
    Can you verify that every sequence line in the FASTA has the same length?

    Comment


    • #3
      I am having this same issue. While I have verified that there are lines of different length in the sequence file, however, why should this matter?

      Comment


      • #4
        This bioperl snippet fixes the fasta:

        Code:
        use Bio::SeqIO;
        $in  = Bio::SeqIO->new(-file => "inputfilename",
                               -format => 'Fasta');
        $out = Bio::SeqIO->new(-file => ">outputfilename",
                               -format => 'Fasta');
        while ( my $seq = $in->next_seq() ) {$out->write_seq($seq); }

        Comment


        • #5
          I had this problem too, my solution was to use unix command to trim and fold the fasta file. You would have to cut the header first, and catenate it with your sorted fasta file. It perfectly solves the problem.

          Writing a shell script may be a good idea to make things easlier.

          Comment


          • #6
            Originally posted by baohua100 View Post
            populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
            [fai_build_core] different line length in sequence 'scaffold_28'.
            Segmentation fault

            What's the meaning of defferent line length ?
            I just found the same thing when there are blank lines in the FASTA file. The message "different line length" is very misleading in this case. I'll report this bug.

            Comment


            • #7
              Thanks very much webbrewer for your bioperl fix, it worked perfectly.

              Comment


              • #8
                Originally posted by webbrewer View Post
                This bioperl snippet fixes the fasta
                Just for anyone interested here is the Biopython equivalent:

                Code:
                from Bio import SeqIO
                SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")
                The convert function returns the number of records if you wanted that information.

                Comment


                • #9
                  I faced the same problem, but solved with webbrewer's code!

                  Originally posted by webbrewer View Post
                  This bioperl snippet fixes the fasta:

                  Code:
                  use Bio::SeqIO;
                  $in  = Bio::SeqIO->new(-file => "inputfilename",
                                         -format => 'Fasta');
                  $out = Bio::SeqIO->new(-file => ">outputfilename",
                                         -format => 'Fasta');
                  while ( my $seq = $in->next_seq() ) {$out->write_seq($seq); }
                  Thanks a lot!

                  Comment


                  • #10
                    Hello, I have the same problem. I found the last lines in fa file likes:
                    Code:
                    ggttagggtgtggtgtgtgggtgtgtgtgggtgtggtgtgtgtgggtgtg
                    gtgtgtgggtgtgggtgtgggtgtgggtgtgtgggtgtggtgtgtgggtg
                    tggT
                    That means the last line has not the same length with others.
                    My question is that can I manually modify instead of using a software.
                    I don't want to install too many software because of rare usage.

                    Thanks.

                    Comment


                    • #11
                      The problem is that your FASTA file has a blank lines in it.
                      you need to get rid of them!!!

                      you can :g/^$/d in vi/vim editor.

                      Comment


                      • #12
                        Originally posted by michmich View Post
                        The problem is that your FASTA file has a blank lines in it.
                        you need to get rid of them!!!

                        you can :g/^$/d in vi/vim editor.
                        Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

                        I then looked at my fasta file in vim and it does not have any blank lines in the file.

                        Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

                        Thank you in advance for your help.
                        jdjax
                        Ph.d. Student
                        Åarhus University

                        Comment


                        • #13
                          Originally posted by jdjax View Post
                          Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

                          I then looked at my fasta file in vim and it does not have any blank lines in the file.

                          Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

                          Thank you in advance for your help.
                          Figured it out on my own.
                          jdjax
                          Ph.d. Student
                          Åarhus University

                          Comment


                          • #14
                            Originally posted by jdjax View Post
                            Figured it out on my own.
                            For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.

                            Comment


                            • #15
                              Originally posted by maubp View Post
                              For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.
                              It actually was blank lines. There were two blank lines at the end of my file that caused the problem.
                              jdjax
                              Ph.d. Student
                              Åarhus University

                              Comment

                              Latest Articles

                              Collapse

                              • seqadmin
                                Current Approaches to Protein Sequencing
                                by seqadmin


                                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                                04-04-2024, 04:25 PM
                              • seqadmin
                                Strategies for Sequencing Challenging Samples
                                by seqadmin


                                Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                                03-22-2024, 06:39 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by seqadmin, 04-11-2024, 12:08 PM
                              0 responses
                              30 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 10:19 PM
                              0 responses
                              32 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 09:21 AM
                              0 responses
                              28 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-04-2024, 09:00 AM
                              0 responses
                              52 views
                              0 likes
                              Last Post seqadmin  
                              Working...
                              X