[jgroh]

Does gapfiller create problems for downstream alignment

Hello,

I'm interested in using GapFiller, however I am wondering whether this might cause issues for downstream alignment. In particular, if the original assembly contigs comprise close to the entire genome, but they were not all able to be scaffolded, then will using GapFiller essentially cause these sequences to be duplicated in the final reference sequence? For instance if contig B was not able to be scaffolded between contig A and contig C, but paired reads can be used by GapFiller to fill in the sequence of contig B, this would mean that reads which originate from the sequence contained in contig B will map equivocally to both contig B and the scaffold in between contig A and contig C. Is this correct, and is not expected to create any problems such as genome inflation and equivocal mapping?

Jeff

[Markiyan]

Can GapFiller accept known repeats sequences?

Can GapFiller accept know repeats sequences in multifasta format, and use those to improve repeats resolution?:

1. First map the known repeats to the assembly.
2. Avoid using reads anchored only in the repetitive region, and first rely only onto reads anchoring onto unique sequence flanking the repetitive regions.
3. Do a mini assembly of the gap caused by the repeat, if unable to close the gap de novo - use the repeat sequence as a base for consensus and map the mates/de novo miniassembly contigs to it. Correct the consensus, where contigs are of a sufficient quality (>Q35?) and have no high quality unaligned portions to the repeat consensus.

PS: While the pilon is quite a good tool, it has problems when used in the iterative mode (like IMAGE), that areas extending into the repeats attract all reads from the other repeat copies during the next mapping step, stalling the repeat extension/gap closures for the robed repeat copies.

PPS: Getting a repeats library for PCR-free datasets: get the median coverage for the assembly, and do subsambling with low coverage assembly (2x-4x) in order to get the repetitive sequences (check contig coverage for that).

[toddknutson]

You need to supply Gap Filler with a single FASTA (not multi-fasta) file. Thus, you need to submit a file like this:


>all_contigs_linked_with_N's
ACGTACGT
ACGTACGT
ACNNNNN
NNNNNNN
NNNNNAC
GTACGTA


and NOT:
>contig1
ACTGT
>contig2
ACGTGACT

[toddknutson]

I am having same problem. did you figure out how to fix it?

You need to supply Gap Filler with a single FASTA (not multi-fasta) file. Thus, you need to submit a file like this:


>all_contigs_linked_with_N's
ACGTACGT
ACGTACGT
ACNNNNN
NNNNNNN
NNNNNAC
GTACGTA


and NOT:
>contig1
ACTGT
>contig2
ACGTGACT

[yifangt]

IMAGE manual

Hello,
Can anyone share your experience using IMAGE for gap closing. I could not get it run after a couple of hours try. I need you explain the options for IMAGE command line for me,

/absolute_path_of_image/image.pl -scaffolds scaffolds.fa -prefix 76bp -iteration 1 -all_iteration 10 -dir_prefix iter

Particularly the -prefix option. From my understanding, it is the prefix of the paired end fastq file.
1) Should the fastq file be in the current directory? which did not work in my case.
2) What if the reads are fasta files which are used for my assembly?
Try to find the manual by writing to the author/group, no response. Googled a while, no luck. Tried PAGIT which is now the bundle including IMAGE, no instruction either.

Thanks a lot!

YT

[mht]

Hi boetsie,

I notice that GapFiller is introducing N's into my contigs where it previously has nucleotides. I've tried -t 0 but it still does not work. Any idea why this is and how this can be solved?

Thanks.
mh


Correction: my bad, it's an actual gap. sorry about this.

[a_crisp]

Using single-end reads

Hi,
Is it possible to use the program with single-end reads? Specifically Pacbio reads.
Thanks,
Alastair

[usad]

The ^M would indicate you have a windows file on a linux system.
Try dos2unix on the script and try again.

[Tom_C]

Hello all,

I would like to use GapFiller, however am receiving the following error when running the command for Gapfiller:

-bash: ./GapFiller.pl: /usr/bin/perl^M: bad interpreter: No such file or directory

I am not quite computer savvy enough to figure this one out, anyone else getting this message?

[DAPOR]

Hi Davide,

I had the same issue when started to use GF. As I recall I've downloaded bowtie folder just from bowtie site ( bowtie-bio.sourceforge.ne ) and replaced "bowtie" folder in SSPACE folder.

Hope that helps.
Cheers,
Stepan

Hi Stepan

Thanks. I tried again to download bowtie from the website and it works with another genome. I think I have some problem with the genome I was working before. I will try to fix it.

Davide

[stepa_t]

Hi Davide,

I had the same issue when started to use GF. As I recall I've downloaded bowtie folder just from bowtie site ( bowtie-bio.sourceforge.ne ) and replaced "bowtie" folder in SSPACE folder.

Hope that helps.
Cheers,
Stepan

[DAPOR]

Hi,

I am am trying to use GapFiller. I succeed to run the test and everything works fine. The problems start when I try to use my data (of course). I have a 250 bp paired-end data in fastq file and the scaffold (in fasta) from SSPACE. When I run the command for GapFiller it seems that it does not load the fastq reads and I get this output.

""
Your inserted inputs on [GapFiller_v1-10] at Thu Jun 26 10:17:35 2014:
-s En.hirae_INFE1.fa
-l libraries.txt
-b test
-o 2
-m 30
-r 0.7
-n 10
-T 1
-g 1
-d 50
-t 10
-i 3


=>Thu Jun 26 10:17:35 2014: Reading and processing paired-read files

ITERATION 1:

=>Thu Jun 26 10:17:47 2014: Mapping reads to scaffolds, reading bowtie output and storing unmapped reads

=>Thu Jun 26 10:17:47 2014: Building BWA index for library lib1

=>Thu Jun 26 10:17:47 2014: Filling gaps

Closed 0 out of 0 gaps
Closed 0 out of 0 nucleotides

All gaps are closed. Exiting...

Process run successfully on Thu Jun 26 10:17:52 2014 in 0 minutes and 17 seconds
""

The fastq files are in the folder together with the library.txt file and the name is correct in the library.txt file.
This happen when I use bwa. If I use bowtie I get this error (like others):

Bowtie-build error; 256 at /Users/davipo/Desktop/fastq-tools/GapFiller_v1-10_/GapFiller.pl line 242.


If I run the test it works with both bowtie and bwa.

Someone knows what I do wrong?

Thanks

Davide

[RhiP]

error - invalid fastq

I am receiving an error when running SSPACE to get a scaffold for GAPfiller.
"ERROR: Invalid file in library Lib1: ~/scratch/bob/lotus/Illumina_3kb_1_R1.fastq -- fatal"

Below is what the head of my fastq file looks like and I don't see where there may be a formatting error. Has anyone else seen and fixed this error?

@DBRHHJN1:175:C011MACXX:3:1101:1149:1049 1:N:0:ATCACG
TCAGGGCATTTTTTGATGCTTCACATTCCTTATGG
+
;@@DDDDBHF?HAHCAFEEFF<<9CDDGEGHCFGF
@DBRHHJN1:175:C011MACXX:3:1101:1087:1093 1:N:0:ATCACG
TCACGAGTCAAGCTAACATAGCTTGTGAAAAGCCT
+
@@@FFDDD>DFHFFEEEGHIIEHHIIH@GGGGGEH

Thanks!

[Dagga]

Thanks for the tips! I have finally got this program working.

I was wondering if anyone has any tips on a starting region for the error settings that are inputted into the library file.

I have a bacterial genome approximately 9Mb in size using an insert size of ~400-500.

I know it will be variable but I was just after a good place to start. I noticed the manual uses 0.25 but this is with an insert size of 1000.

Anyway, any opinions on where to start would be helpful thanks!

[shuixia100]

Hi Marten,

Thanks for the tool for gap filling. However, I had some problem running it , basically the problem is it stopped at the the bowtie-build which is the first step of bowtie. I checked the align output file, it turned out that asem1.contig.gpfill.gapclosure.fa is empty. I tried to read through your perl script but failed to understand how asem1.contig.gpfill.gapclosure.fa is generated so I couldn't figure out why this is empty. Could you please let me know the possible reason of it? Thank you very much!

-rw-r--r-- 1 users 40 2013-03-08 06:10 asem1.contig.gpfill.bowtieIndex.1.ebwt
-rw-r--r-- 1 users 4 2013-03-08 06:10 asem1.contig.gpfill.bowtieIndex.2.ebwt
-rw-r--r-- 1 users 0 2013-03-08 06:10 asem1.contig.gpfill.gapclosure.fa



perl ~/bin/GapFiller_v1-11_linux-x86_64/GapFiller.pl -l libraries -s asem1.contig -m 30 -o 3 -r 0.7 -n 10 -d 50 -t 0 -g 0 -T 1 -i 1 -b asem1.contig.gpfill

Your inserted inputs on [GapFiller_v1-11_Final] at Fri Mar 8 05:37:25 2013:
-s asem1.contig
-l libraries
-b asem1.contig.gpfill
-o 3
-m 30
-r 0.7
-n 10
-T 1
-g 0
-d 50
-t 0
-i 1


=>Fri Mar 8 05:37:25 2013: Reading and processing paired-read files

ITERATION 1:

=>Fri Mar 8 06:10:25 2013: Mapping reads to scaffolds, reading alignment output and storing reads
Warning: Empty input file
Reference file does not seem to be a FASTA file
Command: /home/bin/GapFiller_v1-11_linux-x86_64/bowtie/bowtie-build --quiet --noref asem1.contig.gpfill/alignoutput/asem1.contig.gpfill.gapclosure.fa asem1.contig.gpfill/alignoutput/asem1.contig.gpfill.bowtieIndex

Bowtie-build error; 256 at /home/bin/GapFiller_v1-11_linux-x86_64/GapFiller.pl line 242.

I am having same problem. did you figure out how to fix it?