Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • senkewiczs
    Junior Member
    • Jul 2012
    • 5

    Problem working with DEXSeq package

    Hi I'm new to SEQanswers, and fairly new to bioinformatics, but I'm trying to work with the python scripts for the DEXSeq R package through Bioconductor.

    We have paired-end data from human samples, (4 controls 4 treatments), using SOLID. I have access to the BAM files, that were aligned using TopHat (hg19).

    Whenever I get the text output I have nothing but 0 values for all the count values. I was able to work through some of the example data, but am having no luck with our actual data.

    Here are the steps I've taken (and admittedly I'm using the code(s) provided with the packages). I personally don't do a lot of programming but am actively learning, including from many resources I've found browsing the forums on SEQAnswers.

    -Went to http://useast.ensembl.org/info/data/ftp/index.html and obtained the gtf file for humans, and put it in a folder with the python scripts dexseq_prepare annotation.py & dexseq_count.py, and the human bam files.

    In bash terminal:
    - gunzip Homo_sapiens.GRCh37.67.gtf.gz
    - python dexseq_prepare_annotation.py Homo_sapiens.GRCh37.67.gtf Homo_sapiens.GRCh37.67_DEXSeq.gff

    - samtools index human1.bam
    - samtools view human1.bam > human1.sam
    - sort -k 1,1 -k2,2n human1.sam > human1_sorted.sam
    - python dexseq_count.py Homo_sapiens.GRCh37.67_DEXSeq.gff human1_sorted.sam human1_dexseq.txt

    The above executes, and I get a .txt file, but always gets 0 values for all of our samples. I originally thought it might be that we were using SOLID data; however, I also tried with some human Illumina data and had the same end result. Because the only entry not containing the a 0 value is the "empty" I'm thinking it is a problem I have either with the gtf/gff file or more likely not sorting the SAM file properly. Is the above correct? Or am I missing something? Also does the gff file need sorted as well?

    Any help is much appreciated. Thank you. Oh and if it helps I'm working on a Mac OS X 10.7.4.
  • areyes
    Senior Member
    • Aug 2010
    • 165

    #2
    Hi senkewiczs,

    Do you get a message when running "dexseq_count.py" saying: "X number of reads processed"?

    Could you include the first lines of your files Homo_sapiens.GRCh37.67_DEXSeq.gff and human1_sorted.sam ???

    Thanks,
    Alejandro

    Comment

    • senkewiczs
      Junior Member
      • Jul 2012
      • 5

      #3
      Hi Alejandro,

      Yes, I was getting 'xxxx number of reads processed.'

      Here is the head of human1_sorted.sam:
      PHP Code:
      1000_1000_1096    73    chr2    110601762    0    50M    *    0    0    CTGTCCAAATGGAAAAATTATTAAACAAATCTTTTTTAAAATAAAATGCT    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII:    RG:Z:20110216225354574    NH:i:0    CM:i:0    SM:i:1    CQ:Z:BBABBBA?@ABBA@?@@A@BB?B@A>=@>A=AA??@@@><?@?==@;<6:    CS:Z:T22112010031020000303303001100322000003000330003132
      1000_1000_1096    133    *    0    0    *    chr2    108495505    0    NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN    *    RG:Z:20110216225354574    NH:i:0    CQ:Z:BBA@BB@+<?B><>A>2'%@A?13:==3%@BA)5%    CS:Z:G00103210022022202223321212322331323
      1000_1000_1096    133    *    0    0    *    chr2    110601762    0    NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN    *    RG:Z:20110216225354574    NH:i:0    CQ:Z:BBA@BB@+<?B><>A>2'%@A?13:==3%@BA)5%    CS:Z:G00103210022022202223321212322331323
      1000_1000_1587    81    chr3    96336408    0    25H25M    =    96336433    86    AGGCTTATGCGGAGGAGAATGTTTT    FIIIIIIIIIIIIIIIIIIIIIIII    RG:Z:20110216225354574    NH:i:2    CM:i:0    SM:i:3    CQ:Z:@<@;<;>;>?>?==>@:5@=85:>-:>8:99=.?9><:?9>:1?69><93    CS:Z:T30001130222022033133023021331212230300011123012202
      1000_1000_1587    161    chr3    96336433    0    33M2H    =    96336408    -86    CATGTTACTTATACTAACATTAGTTCTTCTATA    IH8IHGII>.<H=7AIII=2?IE7.CD0+>II8    RG:Z:20110216225354574    NH:i:2    CM:i:0    SM:i:3    CQ:Z:B@)0A(@;9&)45)/3@>1-&:42&);*'%:@/*)    CS:Z:G31311031203331230113032102202233321
      1000_1000_1673    99    chr14    79703924    51    50M    =    79703974    84    AGAGACACTGGGCCTTTTCTCCTTTACTCCAAGAAGAAATGCTCTTTTTT    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII=    RG:Z:20110216225354574    NH:i:1    CM:i:0    SM:i:100    CQ:Z:BBBBAA<BBA@ABBBBABBB@BAA>BAB?B@>BAAB?@B>;@A@<BB>==    CS:Z:T32222111210030200022202003122010220220031322200000
      1000_1000_1673    147    chr14    79703974    51    35M    =    79703924    -84    CATATATCTTTATTGAATACCTATTATGGTCCATG    @IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    RG:Z:20110216225354574    NH:i:1    CM:i:0    SM:i:65    CQ:Z:BBB?BBBBABB)BABBBAA=AA7AA=;A@AA??=@    CS:Z:G31310210133033201330210330022333331
      1000_1000_1921    83    chr10    15880069    45    6H44M    =    15879996    -116    TAATTTAAAGGCAAATTAATCCTGAAGCAATGGATTTAAAATTT    EIIBIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    RG:Z:20110216225354574    NH:i:1    CM:i:0    SM:i:97    CQ:Z:BBBB=>@BB:A>BB@97BB;;=BB<;0BB@99>@<4>@@=03<A%%)%;8    CS:Z:T30030003003201301320212023030300130200300303333030
      1000_1000_1921    163    chr10    15879996    45    33M2H    =    15880069    116    TTAATGTTTTTGAAAAGCGTATCTGGGTAGTTA    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIC    RG:Z:20110216225354574    NH:i:1    CM:i:0    SM:i:58    CQ:Z:B6BBBB7ABB?9BABB)BBAB.@<B?4A5=;2<(B    CS:Z:G10303110000120002331332210013210333
      1000_1000_260    99    chr2    145882329    42    50M    =    145882410    112    AATGTATACAGGACTTATATGCTGAAAACATGTTGCTGAAAAAATCAAAG    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII7AIIIIIIII1    RG:Z:20110216225354574    NH:i:1    CM:i:0    SM:i:100    CQ:Z:BBBA@BABA=7@@A<<ABA?@B@@<;4?@=B=>98B=@83%=A@=0?@?1    CS:Z:T30311333112021203333132120001131101321200000321002


      Here is the head of Homo_sapiens.GRCh37.67_DEXSeq.gff:

      PHP Code:
      1    Homo_sapiens.GRCh37.67.gtf    aggregate_gene    11869    14412    .    +    .    gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    11869    11871    .    +    .    transcripts "ENST00000456328"exonic_part_number "001"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    11872    11873    .    +    .    transcripts "ENST00000456328+ENST00000515242"exonic_part_number "002"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    11874    12009    .    +    .    transcripts "ENST00000456328+ENST00000515242+ENST00000518655"exonic_part_number "003"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    12010    12057    .    +    .    transcripts "ENST00000456328+ENST00000515242+ENST00000450305+ENST00000518655"exonic_part_number "004"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    12058    12178    .    +    .    transcripts "ENST00000456328+ENST00000515242+ENST00000518655"exonic_part_number "005"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    12179    12227    .    +    .    transcripts "ENST00000456328+ENST00000515242+ENST00000450305+ENST00000518655"exonic_part_number "006"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    12595    12612    .    +    .    transcripts "ENST00000518655"exonic_part_number "007"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    12613    12697    .    +    .    transcripts "ENST00000456328+ENST00000515242+ENST00000450305+ENST00000518655"exonic_part_number "008"gene_id "ENSG00000223972"
      1    Homo_sapiens.GRCh37.67.gtf    exonic_part    12698    12721    .    +    .    transcripts "ENST00000456328+ENST00000515242+ENST00000518655"exonic_part_number "009"gene_id "ENSG00000223972" 
      It appears that part of the problem is differences in the annotation of chromosomes between the two files?

      Thanks in advance for any advice......

      Comment

      • areyes
        Senior Member
        • Aug 2010
        • 165

        #4
        Indeed, I believe that is the problem! The chromosome names should match

        Alejandro

        Comment

        • Ashwini Kumar
          Junior Member
          • Aug 2012
          • 6

          #5
          Hi there,

          I am new to DEXSeq. I want to know how to calculate the number of reads mapping to each of the exons of a genome. I mean how to prepare input for the DEXSeq analysis.

          Many thanks
          Ashwini

          Comment

          • areyes
            Senior Member
            • Aug 2010
            • 165

            #6
            Hi Ashwini,

            The pasilla package is an example dataset for the DEXSeq vignette and in the pasilla vignette you will find the steps to create an ExonCountSet object.

            Alejandro

            Comment

            • Ashwini Kumar
              Junior Member
              • Aug 2012
              • 6

              #7
              Hi Alejandro,

              Thanks for your quick response. OK I think in section 9 I can found this creating ExonCountSet objects. can you please also let me know that do I need to write any python script or I can found this in the DEXSeq package.

              Thanks again
              Ashwini
              Ashwini

              Comment

              • areyes
                Senior Member
                • Aug 2010
                • 165

                #8
                You will find these scripts in the DEXSeq package directory!
                Last edited by areyes; 08-21-2012, 07:08 AM.

                Comment

                • Ashwini Kumar
                  Junior Member
                  • Aug 2012
                  • 6

                  #9
                  Many Thanks!!!!!!!!!!!!!! Alejandro
                  You saved me

                  Comment

                  • Ashwini Kumar
                    Junior Member
                    • Aug 2012
                    • 6

                    #10
                    Hi Alejandro,

                    I have run both the python scripts-
                    1.[akumar@mars python_scripts]$ /apps/python262/bin/python dexseq_prepare_annotation.py /homes/akumar/PROJECT_FOLDER/Homo_sapiens.GRCh37.68.gtf Homo_sapiens.GRCh37.68.gff

                    2. [akumar@mars python_scripts]$ /apps/python262/bin/python dexseq_count.py Homo_sapiens.GRCh37.68.gff /homes/akumar/PROJECT_FOLDER/tophat_paired_sorted.sam Output.txt

                    Now the output is -48100000 reads processed.

                    [akumar@mars python_scripts]$ head Output.txt
                    ENSG00000000003:001 6
                    ENSG00000000003:002 0
                    ENSG00000000003:003 1
                    ENSG00000000003:004 1
                    ENSG00000000003:005 0
                    ENSG00000000003:006 0
                    ENSG00000000003:007 0
                    ENSG00000000003:008 0
                    ENSG00000000003:009 1
                    ENSG00000000003:010 0

                    So now what I have to do, how to create ExonCountSet and how to do the further analysis. I am stuck here, please help me.

                    Many thanks
                    Ashwini

                    Comment

                    • areyes
                      Senior Member
                      • Aug 2010
                      • 165

                      #11
                      Check the function read.HTSeqCounts from DEXSeq. This will read this files, parse relevant information for the package and return an ExonCountSet object in your R session.

                      Comment

                      • Ashwini Kumar
                        Junior Member
                        • Aug 2012
                        • 6

                        #12
                        Thanks Alejandro

                        Comment

                        • Ashwini Kumar
                          Junior Member
                          • Aug 2012
                          • 6

                          #13
                          Hi Alejandro,

                          I am wondering that when I am converting the bam file to sam file using samtools at that time is there any need to sort the sam file. If so then which command I have to use.

                          Thanks
                          Ashwini

                          Comment

                          • Simon Anders
                            Senior Member
                            • Feb 2010
                            • 995

                            #14
                            Originally posted by Ashwini Kumar View Post
                            I am wondering that when I am converting the bam file to sam file using samtools at that time is there any need to sort the sam file. If so then which command I have to use.
                            Sorting is required only for paired-end data; for single-end data, there is no need for sorting. To sort by read name, use 'samtools sort -n'.

                            Comment

                            • gokhulkrishnakilaru
                              Member
                              • Jul 2011
                              • 39

                              #15
                              Originally posted by areyes View Post
                              Indeed, I believe that is the problem! The chromosome names should match

                              Alejandro
                              So should we add "chr" to the gff file?

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 10:26 AM
                              0 responses
                              15 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              29 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              16 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              33 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...