Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Tophat 2.0.3 and 2.0.4 failed in Mapping left_kept_reads to genome....

    Hi!

    I am running my RNAseq data set with Tophat 2.0.3 and 2.0.4 and I got a fail when Bowtie start to map the "left_kept_reads" into the genome.


    [2012-07-18 18:00:00] Beginning TopHat run (v2.0.4)
    -----------------------------------------------
    [2012-07-18 18:00:00] Checking for Bowtie
    Bowtie version: 2.0.0.5
    [2012-07-18 18:00:00] Checking for Samtools
    Samtools version: 0.1.18.0
    [2012-07-18 18:00:00] Checking for Bowtie index files
    [2012-07-18 18:00:00] Checking for reference FASTA file
    [2012-07-18 18:00:00] Generating SAM header for /home/volatile/tefa/Programas/bowtie2-2.0.0-beta5/indexes/Danio_rerio.Zv9.60.dna.toplevel
    format: fastq
    quality scale: phred33 (default)
    [2012-07-18 18:00:03] Preparing reads
    left reads: min. length=100, max. length=100, 46097947 kept reads (753470 discarded)
    right reads: min. length=100, max. length=100, 46737157 kept reads (114260 discarded)
    [2012-07-18 18:47:19] Mapping left_kept_reads to genome Danio_rerio.Zv9.60.dna.toplevel with Bowtie2
    /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx)
    /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering)
    Line 91407353, sequence length 74 vs 100 from CIGAR
    Parse error at line 91407353: CIGAR and sequence length are inconsistent
    [FAILED]
    Error running bowtie:


    That's weird, because I didn't get this error when I run the same data set with Tophat 2.0.0.....The version 2.0.0 works well

    Anyone have an idea to solve it????

    TEFA

  • #2
    Originally posted by TEFA View Post
    Hi!

    I am running my RNAseq data set with Tophat 2.0.3 and 2.0.4 and I got a fail when Bowtie start to map the "left_kept_reads" into the genome.


    [2012-07-18 18:00:00] Beginning TopHat run (v2.0.4)
    -----------------------------------------------
    [2012-07-18 18:00:00] Checking for Bowtie
    Bowtie version: 2.0.0.5
    [2012-07-18 18:00:00] Checking for Samtools
    Samtools version: 0.1.18.0
    [2012-07-18 18:00:00] Checking for Bowtie index files
    [2012-07-18 18:00:00] Checking for reference FASTA file
    [2012-07-18 18:00:00] Generating SAM header for /home/volatile/tefa/Programas/bowtie2-2.0.0-beta5/indexes/Danio_rerio.Zv9.60.dna.toplevel
    format: fastq
    quality scale: phred33 (default)
    [2012-07-18 18:00:03] Preparing reads
    left reads: min. length=100, max. length=100, 46097947 kept reads (753470 discarded)
    right reads: min. length=100, max. length=100, 46737157 kept reads (114260 discarded)
    [2012-07-18 18:47:19] Mapping left_kept_reads to genome Danio_rerio.Zv9.60.dna.toplevel with Bowtie2
    /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx)
    /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering)
    Line 91407353, sequence length 74 vs 100 from CIGAR
    Parse error at line 91407353: CIGAR and sequence length are inconsistent
    [FAILED]
    Error running bowtie:


    That's weird, because I didn't get this error when I run the same data set with Tophat 2.0.0.....The version 2.0.0 works well

    Anyone have an idea to solve it????

    TEFA
    Hi Guys,

    I got a similar error message in regards to /fix_map_ordering: /usr/lib64/libz.so.1: no version information available . However, TopHat completes the run. As far as I understand, this message is due to the binaries being used were precompiled with an updated version of zlib compared to which I am currently running in the server. It could be solved by building TopHat from source, something which I could not accomplish due to boost errors while builiding (make). Have you tried builiding it from source?

    Does this warning/error affects the output/s at all?
    Thanks in advance.

    Cheers,

    Fernando
    Last edited by fjrossello; 08-14-2012, 02:32 AM. Reason: Typo

    Comment


    • #3
      Hi, the same thing happens with me. I also tried installing boost, but it doesn't make. I also tried running the binaries but I get the same error message.

      Comment


      • #4
        I installed the binary version of tophat-2.0.4 because the manual install failed because I wasn't able to install boost properly (for me this is a separate issue).

        This is what I get after trying to run tophat-2.0.4:

        [2012-08-29 23:16:17] Reporting output tracks
        [FAILED]
        Error running /home/ladunga/csmatyi/bin/tophat-2.0.4.Linux_x86_64/tophat_reports --min-anchor 8 --splice-mismatches 2 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.1 --output-dir /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/ --max-multihits 1 --max-seg-multihits 10 --segment-length 35 --segment-mismatches 1 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --max-mismatches 2 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p8 --gtf-annotations /work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/files/Osativa_193_transcript.gff --gtf-juncs /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/Osativa_193_transcript.juncs --no-closure-search --no-microexon-search --library-type fr-unstranded --sam-header /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/Osativa_193_genome.bwt.samheader.sam --report-discordant-pair-alignments --report-mixed-alignments --samtools=/home/ladunga/csmatyi/bin/samtools-0.1.18/samtools --bowtie2-max-penalty 6 --bowtie2-min-penalty 2 --bowtie2-penalty-for-N 1 --bowtie2-read-gap-open 5 --bowtie2-read-gap-cont 3 --bowtie2-ref-gap-open 5 --bowtie2-ref-gap-cont 3 /work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/files/Osativa_193.fa /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/junctions.bed /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/insertions.bed /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/deletions.bed /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/fusions.out /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/accepted_hits /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/left_kept_reads.m2g_um.candidates_and_unspl.bam /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/left_kept_reads.bam
        Error: CIGAR and sequence length are inconsistent!(GTGGTACTACGTCCCTGCCCTTTGTACACACCGCC)


        1. How can I solve this?
        2. Do I have to install the libz.so.1 file somewhere?
        3. If I try to manually install tophat-2.0.4, then how can I get boost to install properly?

        Thanks!

        -csmatyi

        Comment


        • #5
          Same thing is happening to me...

          I'm having troubles to get a result from tophat v2.0.4. I've previously been able to run this exact task with the same fastq files, but now it seems the same command doesn't work . I thought it was because I was now trying to include a reference gtf file downloaded from the UCSC "Table browser". I downloaded the Refseq mm9 gtf file. I tried to perform a tophat alignment but after running for more than 5 hours the program keeps failing at the last part of the process.

          Here is my error log :

          [2012-10-02 12:46:02] Beginning TopHat run (v2.0.4)
          -----------------------------------------------
          [2012-10-02 12:46:02] Checking for Bowtie
          Bowtie 2 not found, checking for older version..
          Bowtie version: 0.12.3.0
          [2012-10-02 12:46:02] Checking for Samtools
          Samtools version: 0.1.18.0
          [2012-10-02 12:46:02] Checking for Bowtie index files
          [2012-10-02 12:46:02] Checking for reference FASTA file
          [2012-10-02 12:46:02] Generating SAM header for /home/jllavin/bowtie-0.12.7/indexes/mm9
          format: fastq
          quality scale: solexa33 (reads generated with GA pipeline version < 1.3)
          [2012-10-02 12:46:33] Reading known junctions from GTF file
          [2012-10-02 12:46:37] Preparing reads
          left reads: min. length=50, max. length=50, 31307597 kept reads (3347 discarded)
          right reads: min. length=50, max. length=50, 31066293 kept reads (244651 discarded)
          [2012-10-02 13:04:54] Creating transcriptome data files..
          [2012-10-02 13:05:58] Building Bowtie index from mm9.refseq.fa
          [2012-10-02 13:14:51] Mapping left_kept_reads to transcriptome mm9.refseq with Bowtie
          [2012-10-02 13:21:51] Mapping right_kept_reads to transcriptome mm9.refseq with Bowtie
          [2012-10-02 13:28:44] Resuming TopHat pipeline with unmapped reads
          [2012-10-02 13:28:44] Mapping left_kept_reads.m2g_um to genome mm9 with Bowtie
          [2012-10-02 14:26:05] Mapping left_kept_reads.m2g_um_seg1 to genome mm9 with Bowtie (1/3)
          [2012-10-02 14:52:09] Mapping left_kept_reads.m2g_um_seg2 to genome mm9 with Bowtie (2/3)
          [2012-10-02 15:17:28] Mapping left_kept_reads.m2g_um_seg3 to genome mm9 with Bowtie (3/3)
          [2012-10-02 16:07:24] Mapping right_kept_reads.m2g_um to genome mm9 with Bowtie
          [2012-10-02 17:05:32] Mapping right_kept_reads.m2g_um_seg1 to genome mm9 with Bowtie (1/3)
          [2012-10-02 17:32:39] Mapping right_kept_reads.m2g_um_seg2 to genome mm9 with Bowtie (2/3)
          [2012-10-02 17:58:20] Mapping right_kept_reads.m2g_um_seg3 to genome mm9 with Bowtie (3/3)
          [2012-10-02 18:44:59] Searching for junctions via segment mapping
          [FAILED]
          Error: segment-based junction search failed with err =-11
          Loading left segment hits...

          Here's my command to run Tophat:

          tophat -p 6 --bowtie1 -i 20 -I 20000 --segment-length 20 --solexa-quals --no-coverage-search --no-convert-bam -G /storage/Genomes/gtf_Refseqs/mm9.refseq.gtf -o "path"/sample_dir /bowtie-0.12.7/indexes/mm9 "path"/sample_R1.fastq "path"/sample_R2.fastq`;
          Last edited by Jluis; 10-03-2012, 04:36 AM.

          Comment


          • #6
            Hi guys!

            On my side, I switched to Tophat 2.0 and bowtie 2.0.0.5. That comination works well for me with large data!

            Cheers,


            TEFA

            Comment

            Latest Articles

            Collapse

            • seqadmin
              Recent Advances in Sequencing Analysis Tools
              by seqadmin


              The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
              05-06-2024, 07:48 AM
            • seqadmin
              Essential Discoveries and Tools in Epitranscriptomics
              by seqadmin




              The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
              04-22-2024, 07:01 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, 05-14-2024, 07:03 AM
            0 responses
            20 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-10-2024, 06:35 AM
            0 responses
            44 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-09-2024, 02:46 PM
            0 responses
            54 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-07-2024, 06:57 AM
            0 responses
            42 views
            0 likes
            Last Post seqadmin  
            Working...
            X