Tophat 2.0.3 and 2.0.4 failed in Mapping left_kept_reads to genome....

[TEFA]

Hi!

I am running my RNAseq data set with Tophat 2.0.3 and 2.0.4 and I got a fail when Bowtie start to map the "left_kept_reads" into the genome.


[2012-07-18 18:00:00] Beginning TopHat run (v2.0.4)
-----------------------------------------------
[2012-07-18 18:00:00] Checking for Bowtie
Bowtie version: 2.0.0.5
[2012-07-18 18:00:00] Checking for Samtools
Samtools version: 0.1.18.0
[2012-07-18 18:00:00] Checking for Bowtie index files
[2012-07-18 18:00:00] Checking for reference FASTA file
[2012-07-18 18:00:00] Generating SAM header for /home/volatile/tefa/Programas/bowtie2-2.0.0-beta5/indexes/Danio_rerio.Zv9.60.dna.toplevel
format: fastq
quality scale: phred33 (default)
[2012-07-18 18:00:03] Preparing reads
left reads: min. length=100, max. length=100, 46097947 kept reads (753470 discarded)
right reads: min. length=100, max. length=100, 46737157 kept reads (114260 discarded)
[2012-07-18 18:47:19] Mapping left_kept_reads to genome Danio_rerio.Zv9.60.dna.toplevel with Bowtie2
/home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx)
/home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering)
Line 91407353, sequence length 74 vs 100 from CIGAR
Parse error at line 91407353: CIGAR and sequence length are inconsistent
[FAILED]
Error running bowtie:

That's weird, because I didn't get this error when I run the same data set with Tophat 2.0.0.....The version 2.0.0 works well

Anyone have an idea to solve it????

TEFA

[fjrossello]

Hi!

I am running my RNAseq data set with Tophat 2.0.3 and 2.0.4 and I got a fail when Bowtie start to map the "left_kept_reads" into the genome.


[2012-07-18 18:00:00] Beginning TopHat run (v2.0.4)
-----------------------------------------------
[2012-07-18 18:00:00] Checking for Bowtie
Bowtie version: 2.0.0.5
[2012-07-18 18:00:00] Checking for Samtools
Samtools version: 0.1.18.0
[2012-07-18 18:00:00] Checking for Bowtie index files
[2012-07-18 18:00:00] Checking for reference FASTA file
[2012-07-18 18:00:00] Generating SAM header for /home/volatile/tefa/Programas/bowtie2-2.0.0-beta5/indexes/Danio_rerio.Zv9.60.dna.toplevel
format: fastq
quality scale: phred33 (default)
[2012-07-18 18:00:03] Preparing reads
left reads: min. length=100, max. length=100, 46097947 kept reads (753470 discarded)
right reads: min. length=100, max. length=100, 46737157 kept reads (114260 discarded)
[2012-07-18 18:47:19] Mapping left_kept_reads to genome Danio_rerio.Zv9.60.dna.toplevel with Bowtie2
/home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/bam2fastx)
/home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering: /usr/lib64/libz.so.1: no version information available (required by /home/volatile/tefa/Programas/tophat-2.0.4.Linux_x86_64/fix_map_ordering)
Line 91407353, sequence length 74 vs 100 from CIGAR
Parse error at line 91407353: CIGAR and sequence length are inconsistent
[FAILED]
Error running bowtie:

That's weird, because I didn't get this error when I run the same data set with Tophat 2.0.0.....The version 2.0.0 works well

Anyone have an idea to solve it????

TEFA

Hi Guys,

I got a similar error message in regards to /fix_map_ordering: /usr/lib64/libz.so.1: no version information available . However, TopHat completes the run. As far as I understand, this message is due to the binaries being used were precompiled with an updated version of zlib compared to which I am currently running in the server. It could be solved by building TopHat from source, something which I could not accomplish due to boost errors while builiding (make). Have you tried builiding it from source?

Does this warning/error affects the output/s at all?
Thanks in advance.

Cheers,

Fernando

[csmatyi]

Hi, the same thing happens with me. I also tried installing boost, but it doesn't make. I also tried running the binaries but I get the same error message.

[csmatyi]

I installed the binary version of tophat-2.0.4 because the manual install failed because I wasn't able to install boost properly (for me this is a separate issue).

This is what I get after trying to run tophat-2.0.4:

[2012-08-29 23:16:17] Reporting output tracks
[FAILED]
Error running /home/ladunga/csmatyi/bin/tophat-2.0.4.Linux_x86_64/tophat_reports --min-anchor 8 --splice-mismatches 2 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.1 --output-dir /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/ --max-multihits 1 --max-seg-multihits 10 --segment-length 35 --segment-mismatches 1 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --max-mismatches 2 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p8 --gtf-annotations /work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/files/Osativa_193_transcript.gff --gtf-juncs /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/Osativa_193_transcript.juncs --no-closure-search --no-microexon-search --library-type fr-unstranded --sam-header /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/Osativa_193_genome.bwt.samheader.sam --report-discordant-pair-alignments --report-mixed-alignments --samtools=/home/ladunga/csmatyi/bin/samtools-0.1.18/samtools --bowtie2-max-penalty 6 --bowtie2-min-penalty 2 --bowtie2-penalty-for-N 1 --bowtie2-read-gap-open 5 --bowtie2-read-gap-cont 3 --bowtie2-ref-gap-open 5 --bowtie2-ref-gap-cont 3 /work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/files/Osativa_193.fa /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/junctions.bed /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/insertions.bed /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/deletions.bed /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/fusions.out /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/accepted_hits /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/left_kept_reads.m2g_um.candidates_and_unspl.bam /lustre/work/ladunga/csmatyi/data/RPDB/Osa/GEO_sets/GSE16631/SRP002106/SRR037711_tophat2/tmp/left_kept_reads.bam
Error: CIGAR and sequence length are inconsistent!(GTGGTACTACGTCCCTGCCCTTTGTACACACCGCC)


1. How can I solve this?
2. Do I have to install the libz.so.1 file somewhere?
3. If I try to manually install tophat-2.0.4, then how can I get boost to install properly?

Thanks!

-csmatyi

[Jluis]

Same thing is happening to me...

I'm having troubles to get a result from tophat v2.0.4. I've previously been able to run this exact task with the same fastq files, but now it seems the same command doesn't work . I thought it was because I was now trying to include a reference gtf file downloaded from the UCSC "Table browser". I downloaded the Refseq mm9 gtf file. I tried to perform a tophat alignment but after running for more than 5 hours the program keeps failing at the last part of the process.

Here is my error log :

[2012-10-02 12:46:02] Beginning TopHat run (v2.0.4)
-----------------------------------------------
[2012-10-02 12:46:02] Checking for Bowtie
Bowtie 2 not found, checking for older version..
Bowtie version: 0.12.3.0
[2012-10-02 12:46:02] Checking for Samtools
Samtools version: 0.1.18.0
[2012-10-02 12:46:02] Checking for Bowtie index files
[2012-10-02 12:46:02] Checking for reference FASTA file
[2012-10-02 12:46:02] Generating SAM header for /home/jllavin/bowtie-0.12.7/indexes/mm9
format: fastq
quality scale: solexa33 (reads generated with GA pipeline version < 1.3)
[2012-10-02 12:46:33] Reading known junctions from GTF file
[2012-10-02 12:46:37] Preparing reads
left reads: min. length=50, max. length=50, 31307597 kept reads (3347 discarded)
right reads: min. length=50, max. length=50, 31066293 kept reads (244651 discarded)
[2012-10-02 13:04:54] Creating transcriptome data files..
[2012-10-02 13:05:58] Building Bowtie index from mm9.refseq.fa
[2012-10-02 13:14:51] Mapping left_kept_reads to transcriptome mm9.refseq with Bowtie
[2012-10-02 13:21:51] Mapping right_kept_reads to transcriptome mm9.refseq with Bowtie
[2012-10-02 13:28:44] Resuming TopHat pipeline with unmapped reads
[2012-10-02 13:28:44] Mapping left_kept_reads.m2g_um to genome mm9 with Bowtie
[2012-10-02 14:26:05] Mapping left_kept_reads.m2g_um_seg1 to genome mm9 with Bowtie (1/3)
[2012-10-02 14:52:09] Mapping left_kept_reads.m2g_um_seg2 to genome mm9 with Bowtie (2/3)
[2012-10-02 15:17:28] Mapping left_kept_reads.m2g_um_seg3 to genome mm9 with Bowtie (3/3)
[2012-10-02 16:07:24] Mapping right_kept_reads.m2g_um to genome mm9 with Bowtie
[2012-10-02 17:05:32] Mapping right_kept_reads.m2g_um_seg1 to genome mm9 with Bowtie (1/3)
[2012-10-02 17:32:39] Mapping right_kept_reads.m2g_um_seg2 to genome mm9 with Bowtie (2/3)
[2012-10-02 17:58:20] Mapping right_kept_reads.m2g_um_seg3 to genome mm9 with Bowtie (3/3)
[2012-10-02 18:44:59] Searching for junctions via segment mapping
[FAILED]
Error: segment-based junction search failed with err =-11
Loading left segment hits...

Here's my command to run Tophat:

tophat -p 6 --bowtie1 -i 20 -I 20000 --segment-length 20 --solexa-quals --no-coverage-search --no-convert-bam -G /storage/Genomes/gtf_Refseqs/mm9.refseq.gtf -o "path"/sample_dir /bowtie-0.12.7/indexes/mm9 "path"/sample_R1.fastq "path"/sample_R2.fastq`;

[TEFA]

Hi guys!

On my side, I switched to Tophat 2.0 and bowtie 2.0.0.5. That comination works well for me with large data!

Cheers,


TEFA