Problems using TopHat output in SAMtools

[nat]

hi there,

I have run some RNA seq reads through TopHat and generated the 3 standard output files: accepted_hits.sam
coverage.wig
junctions.bed

Both the .wig and .bed files produce error messages when I tried to import them to UCSC browser - Have other people had problems with TopHat output in UCSC?

I also tried to view accepted_hits.sam using SAMtools, but had a few problems here.

I followed the following steps:
samtools faidx ex1.fa # index the reference FASTA (no problems)

samtools import ex1.fa.fai accepted_hits.sam. accepted_hits.bam # SAM->BAM

here i got the following error message (repeated multiple times)

[sam_read1] reference 'gi|17981852|ref|NC_001807.4|' is recognized as '*'.

[sam_read1] reference 'gi|17981852|ref|NC_001807.4|' is recognized as '*'.


a bam file was still produced, and so i tried using it anyway:

samtools index accepted_hits.bam # index BAM

samtools tview ex1.bam ex1.fa # view alignment

-this just gives me a viewer with a blank screen

samtools pileup -t ref.fa.fai file.sam (all the other options i tried with pileup didnt give any output)

-gives the same error messge i had when i ran 'import'
[sam_read1] reference 'gi|17981852|ref|NC_001807.4|' is recognized as '*'.



Here is the top of my .sam file (there is no header it seems) - it all seems to be in order according to SAM file specifications.

GAPC:1:38:1386:252#0 16 gi|13626247|ref|NT_025975.2|HsY_26131 87997 255 35M * 0 0 TCAATTCCTTGCGATTCCATTACATTCGATTTCTT ]_aaa]VV]a_\`aaa`abaa`^aaabaaabaaaa NM:i:1
GAPC:1:16:1046:505#0 0 gi|14772189|ref|NT_025215.4|Hs20_25371 27969 3 35M * 0 0 CACACCCAATATTATAACAAAAGATTGTAACAAGG ababbba`abbbbbbbbbbbaaMabaOabbbbb[T NM:i:2

Has anyone else had these problems? Any clues!!! Ive been struggling with this for days now

Thanks

[kch]

Hi nat,

This might answer your question: http://seqanswers.com/forums/showthread.php?t=2183

The chromosome field is referring to contigs instead of chromosomes, which the UCSC Browser doesn't understand.