newly sequenced Genome-problems in blast with old one.

[ashiq.hussain]

Dear All,
We have sequenced new genome of an insect. The sequence we got is in fasta nucleotide scaffold form.

>scaffold 7 4.3
AGAATTTACCCTGATAACACAGTGTGTACATGGTATAAAAACAACAAAAATATCGCTGATAACATAATAAAATTGCCTTGTATTGGTCCAACAGCAGCAG
TCGATTTTCAAAACGGAAAGTGTGAGATGGTTTAATAAGTTTCGCAAAATTAATATTTTATTTATTTTTGGATTTCAATGCAAAAATATTAAGTTAAAAA
ATCGGTTATTGAAAAAATGTCAGCAGAAACATTATTTACGCTGCTTGTGGGAATTGTGTTAACGACCTGTGTGAGAGCAGATCAATGTGAGTATTGACAA
TATAAGTAATTACATATATGTATGCACATTATTTTTATTGGAATTTTTTGATATTGACTTTTTACATGCACTATTGCTGTATGTGGTTTNCTCATTATTT
TTATTGGAATTTATTTATATTGACTTTTTACATGTACTATTGCTGTATGTGGTTTTTGAGCATCGATTATTGCTTTATAATAAAATTAATTAATTTTAAT
AAATCTTTTCATTAATTAATTTTTTTTCTATCCCAATGGCAAACATGGTTACTGTTATTCANATAATTAATTTTTTTTCTATTTGTAGATCGTTGCCTAA
ATCCCAATGGCAAACATGGTTACTGTTATTCAATCAATTTGTGCTCCAGTCTGTATGAACTTACGGGAAAGGCTAATTTAACCAACTCGGAAATTCGCTT
TCTTCGTCAATCAAAATGTGATAATGGTTATGGTAATGACTGGCCGTTTCTATGCTGTACGGCGGATATAGATTTCACACCGTCAATACGTTCTGGTAAC
CCATAATAGCCACCGCCAAATCACTTGCTGCCTGTGGAACCAAATTGTGGACCAGCATTTGTTGAAAAAAAGATAATGAATGGTGAAGATGCAGGAGTAT
TTGCTTTTTCGTGGATCGCGCTCCTGGAGTATGAGGAATGTGCGTTAAAATTTGAGAAAATTCGATTTGAATTAATTAATTAATCTAAATTGTAGACGGC
GTACGTTCGCATAAATGCGGTGGCACTTTGATCAATCATCGTTATGTGGTGACAGCGGCACATTGCGTGGGAGATAATTTAAACAGACTGTGAGTATCAA
AACCAGTGACACAGGTAGGGTTAATAAATGGTAGTCTAAAGTTCGCCCTAAAACAGATTATTATATTCAATAGAATTCAGACAGCGATAAATTAAAAAAA
AATAATTCAAAATAAAAACATTTATATAAATAATTATAATCAGTGTTATCTTTCAGCACAACGGCCCGTTTTGGGGAATATGACATCAGCAATCAAATTG
ATTGTGAACAATACTATTGTAACGACTTCGTTGTAGATGTCGAAANATTGATTGTGAACAATACTATTGTAACGACTTCGTTGTAGATGTCGAAATTGAG
AAGGCTATCGCACATCCCAAGTATAATATTAGTAGAAGGGATCATCATAATGACATTGCATTGGTGCGTCTGGCCAGAGATGTTCAATACACCCAATTCA
TAAAGCCTGTTTGTCTGCCTTTGTTAAATGCTGGCCCGACAATCAAAATAAATGACTTGCTTACTGTGAGTGGATGGGGAGTTACACATAAATCAGGTAA
AAGTGTCTTTTAAATTTTGACAGTAATAATATAAATAACTATCAACTAAAGACGTTACACATTCATCCATACATATATAGATAGTATGAGCAAAATTAAA
CAGAGACTGGACGTGCCTGTGTATGACCATAATGACTGCGTCCGTAGATACCAAGAAATTGACGTCGACTTAATACCCTCTCAGCTTTGTGCTGGTGGTG
AATCTGGCAAGGGGAGTTGCTACGGCGATTCCGGTGGTCCACTTATGCGACAAACCCTGGAAAGTTTTTGGTATCTTGAAGGTATTACTTCCACTGGCAA
TGGTTGCGGCGTGGAAGGTTGGCCCGGTATTTATACTCTCGTTGCGGAC

Now we are trying to find homologous genes using the new genome sequence as query with another annotated insect genome of same genus. The problem is every time I do the blastN, I do not find any homologous gene in the new genome even not a similar sequence. how do i find new genes in the newly sequence genome?

any suggestion will be appreciated.

thanks

[maubp]

Are you using the new contigs as the BLASTN queries? I don't think BLAST performs that well with very long queries.

You'd probably get better results turning the new contigs into a BLAST database, and doing a BLASTX search of proteins from other insects against your draft genome.

But this is only one aspect of gene finding

[ashiq.hussain]

thanks Maubp.
How do I turn the new contigs into a BLAST database?
thanks again

[maubp]

Use the makeblastdb command from the standalone NCBI BLAST+ suite. There are several threads on SEQanswers about this tool so have a search if you get stuck.

[jimmybee]

If thats no help, do some de-novo gene finding. Search for a tool that is used regularly in insects and go with that. Some tools include FGENESH, Glimmer, GENScan..

Be mindful that you may have to do some repeatmasking or Transposable Element matching before you start identifying genes using a denovo gene prediction program. Im not sure how repetitive the insect genome you're working with is, but that will be extremely helpful to know in the long term

[Tong.W]

You can try to use NCBI blast noline, it is more convinient ,you just need to copy the sequence above then paste them , then you will see the most homologous genes listed.but I have done it, and find nothing in the return results .It means the nt database dose not contain this sequence .So it maybe a new sequence or other reasons.

[maubp]

You can try to use NCBI blast noline, it is more convinient ,you just need to copy the sequence above then paste them..

For a few manual searches yes, online NCBI BLAST is convenient - provided the database you want to use is supported. But here with thousands of assembled sequences online BLAST is not appropriate.

[Tong.W]

For a few manual searches yes, online NCBI BLAST is convenient - provided the database you want to use is supported. But here with thousands of assembled sequences online BLAST is not appropriate.

Yes you are right,Online blast sustains one sequence .but local blast need to download the database ,it is very huge and require much of the computer source .So you can first use online blast find the best homologous species and then just download the sequence which is best alignment, then use pairwise alignment.It is fast and sometimes very accurate. Because a 1k sequence often is enough as a unique one ,it can represent the species. Or you can use more sequences.

[ashiq.hussain]

thank you all.
The closet homologue will be Drosophila melanogastor as we have also sequence a new Drosophila specie.

We want to find a group of GPCRs genes already annotated in Drosophila in our new sequenced specie.