Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • newly sequenced Genome-problems in blast with old one.

    Dear All,
    We have sequenced new genome of an insect. The sequence we got is in fasta nucleotide scaffold form.

    >scaffold 7 4.3
    AGAATTTACCCTGATAACACAGTGTGTACATGGTATAAAAACAACAAAAATATCGCTGATAACATAATAAAATTGCCTTGTATTGGTCCAACAGCAGCAG
    TCGATTTTCAAAACGGAAAGTGTGAGATGGTTTAATAAGTTTCGCAAAATTAATATTTTATTTATTTTTGGATTTCAATGCAAAAATATTAAGTTAAAAA
    ATCGGTTATTGAAAAAATGTCAGCAGAAACATTATTTACGCTGCTTGTGGGAATTGTGTTAACGACCTGTGTGAGAGCAGATCAATGTGAGTATTGACAA
    TATAAGTAATTACATATATGTATGCACATTATTTTTATTGGAATTTTTTGATATTGACTTTTTACATGCACTATTGCTGTATGTGGTTTNCTCATTATTT
    TTATTGGAATTTATTTATATTGACTTTTTACATGTACTATTGCTGTATGTGGTTTTTGAGCATCGATTATTGCTTTATAATAAAATTAATTAATTTTAAT
    AAATCTTTTCATTAATTAATTTTTTTTCTATCCCAATGGCAAACATGGTTACTGTTATTCANATAATTAATTTTTTTTCTATTTGTAGATCGTTGCCTAA
    ATCCCAATGGCAAACATGGTTACTGTTATTCAATCAATTTGTGCTCCAGTCTGTATGAACTTACGGGAAAGGCTAATTTAACCAACTCGGAAATTCGCTT
    TCTTCGTCAATCAAAATGTGATAATGGTTATGGTAATGACTGGCCGTTTCTATGCTGTACGGCGGATATAGATTTCACACCGTCAATACGTTCTGGTAAC
    CCATAATAGCCACCGCCAAATCACTTGCTGCCTGTGGAACCAAATTGTGGACCAGCATTTGTTGAAAAAAAGATAATGAATGGTGAAGATGCAGGAGTAT
    TTGCTTTTTCGTGGATCGCGCTCCTGGAGTATGAGGAATGTGCGTTAAAATTTGAGAAAATTCGATTTGAATTAATTAATTAATCTAAATTGTAGACGGC
    GTACGTTCGCATAAATGCGGTGGCACTTTGATCAATCATCGTTATGTGGTGACAGCGGCACATTGCGTGGGAGATAATTTAAACAGACTGTGAGTATCAA
    AACCAGTGACACAGGTAGGGTTAATAAATGGTAGTCTAAAGTTCGCCCTAAAACAGATTATTATATTCAATAGAATTCAGACAGCGATAAATTAAAAAAA
    AATAATTCAAAATAAAAACATTTATATAAATAATTATAATCAGTGTTATCTTTCAGCACAACGGCCCGTTTTGGGGAATATGACATCAGCAATCAAATTG
    ATTGTGAACAATACTATTGTAACGACTTCGTTGTAGATGTCGAAANATTGATTGTGAACAATACTATTGTAACGACTTCGTTGTAGATGTCGAAATTGAG
    AAGGCTATCGCACATCCCAAGTATAATATTAGTAGAAGGGATCATCATAATGACATTGCATTGGTGCGTCTGGCCAGAGATGTTCAATACACCCAATTCA
    TAAAGCCTGTTTGTCTGCCTTTGTTAAATGCTGGCCCGACAATCAAAATAAATGACTTGCTTACTGTGAGTGGATGGGGAGTTACACATAAATCAGGTAA
    AAGTGTCTTTTAAATTTTGACAGTAATAATATAAATAACTATCAACTAAAGACGTTACACATTCATCCATACATATATAGATAGTATGAGCAAAATTAAA
    CAGAGACTGGACGTGCCTGTGTATGACCATAATGACTGCGTCCGTAGATACCAAGAAATTGACGTCGACTTAATACCCTCTCAGCTTTGTGCTGGTGGTG
    AATCTGGCAAGGGGAGTTGCTACGGCGATTCCGGTGGTCCACTTATGCGACAAACCCTGGAAAGTTTTTGGTATCTTGAAGGTATTACTTCCACTGGCAA
    TGGTTGCGGCGTGGAAGGTTGGCCCGGTATTTATACTCTCGTTGCGGAC

    Now we are trying to find homologous genes using the new genome sequence as query with another annotated insect genome of same genus. The problem is every time I do the blastN, I do not find any homologous gene in the new genome even not a similar sequence. how do i find new genes in the newly sequence genome?

    any suggestion will be appreciated.

    thanks

  • #2
    Are you using the new contigs as the BLASTN queries? I don't think BLAST performs that well with very long queries.

    You'd probably get better results turning the new contigs into a BLAST database, and doing a BLASTX search of proteins from other insects against your draft genome.

    But this is only one aspect of gene finding
    Last edited by maubp; 08-09-2012, 01:18 AM. Reason: spelling

    Comment


    • #3
      thanks Maubp.
      How do I turn the new contigs into a BLAST database?
      thanks again

      Comment


      • #4
        Use the makeblastdb command from the standalone NCBI BLAST+ suite. There are several threads on SEQanswers about this tool so have a search if you get stuck.

        Comment


        • #5
          If thats no help, do some de-novo gene finding. Search for a tool that is used regularly in insects and go with that. Some tools include FGENESH, Glimmer, GENScan..

          Be mindful that you may have to do some repeatmasking or Transposable Element matching before you start identifying genes using a denovo gene prediction program. Im not sure how repetitive the insect genome you're working with is, but that will be extremely helpful to know in the long term

          Comment


          • #6
            You can try to use NCBI blast noline, it is more convinient ,you just need to copy the sequence above then paste them , then you will see the most homologous genes listed.but I have done it, and find nothing in the return results .It means the nt database dose not contain this sequence .So it maybe a new sequence or other reasons.

            Comment


            • #7
              Originally posted by Tong.W View Post
              You can try to use NCBI blast noline, it is more convinient ,you just need to copy the sequence above then paste them..
              For a few manual searches yes, online NCBI BLAST is convenient - provided the database you want to use is supported. But here with thousands of assembled sequences online BLAST is not appropriate.

              Comment


              • #8
                Originally posted by maubp View Post
                For a few manual searches yes, online NCBI BLAST is convenient - provided the database you want to use is supported. But here with thousands of assembled sequences online BLAST is not appropriate.
                Yes you are right,Online blast sustains one sequence .but local blast need to download the database ,it is very huge and require much of the computer source .So you can first use online blast find the best homologous species and then just download the sequence which is best alignment, then use pairwise alignment.It is fast and sometimes very accurate. Because a 1k sequence often is enough as a unique one ,it can represent the species. Or you can use more sequences.

                Comment


                • #9
                  thank you all.
                  The closet homologue will be Drosophila melanogastor as we have also sequence a new Drosophila specie.

                  We want to find a group of GPCRs genes already annotated in Drosophila in our new sequenced specie.

                  Comment

                  Latest Articles

                  Collapse

                  • seqadmin
                    Exploring the Dynamics of the Tumor Microenvironment
                    by seqadmin




                    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
                    07-08-2024, 03:19 PM
                  • seqadmin
                    Exploring Human Diversity Through Large-Scale Omics
                    by seqadmin


                    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
                    06-25-2024, 06:43 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by seqadmin, 07-10-2024, 07:30 AM
                  0 responses
                  19 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 07-03-2024, 09:45 AM
                  0 responses
                  197 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 07-03-2024, 08:54 AM
                  0 responses
                  206 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 07-02-2024, 03:00 PM
                  0 responses
                  190 views
                  0 likes
                  Last Post seqadmin  
                  Working...
                  X