Need explication about how work the LastGraph file of Velvet

[Wizard50]

Hello everyone,

I'm student in computer science and I work on a bioinformatics project which has to analyze a LastGraph file of Velvet. So I'm not an expert in bioinformatics but I think I know at least the basics to achieve my project. I read the paper about Velvet and the manual.

The problem is now, I have an example of LastGraph file in front of me and I don't understand how it works in relation to the description given in the paper.

In the manual, they say about the nodes :
"This means that the two sequences given above are not reverse-complements of each other but reverse-complements shifted by k nucleotides".
I am not sure to understand that ...

For example, I have in my LastGraph file this node :

NODE	1	161	602	602	0	0	0	0	0	0
ACTAACAGTCCTGTTATATCCCTAGGTCTTTCTAACGCGGGGGCGGCCGTAATTTTGCAATTTACTCCCATTGCTGAGGCTAAAATCAGGGAAATGGTGGTTTTTCCCAGGCCAGGGGGCCCATATAAGAGGAGATGATCCATCGGTTCATTACGGGTTTT
CCCTGATTTTAGCCTCAGCAATGGGAGTAAATTGCAAAATTACGGCCGCCCCCGCGTTAGAAAGACCTAGGGATATAACAGGACTGTTAGTTAGCTTAAAACCAGGAGATATTCTATTTATTGATGAAATTCATCGGCTTAACCGTTTAACCGAAGAATTG

I see that the first 91 nucleotides of each sequence here are the reverse-complements of the first 91 nucleotides of the other sequence.
I thought during a while that each sequence given in this node corresponds to some overlapping words of length k, but this would mean that that last k-1 nucleotides of this node overlap exactly on the first k-1 nucleotides of the node connected to this one. Or in my file, this is never the case.

I think there is something important that I did not understand and I would be very grateful if you could explain it to me.

I have another question : in the Velvet manual, they say at the end that there is a tool named "layout" that allow to transform the LastGraph file into DOT file but it is not inside the last version of Velvet ... did they delete it ?

Thank you for you help !

Best

[cliffbeall]

Try the mailing list?

It's at http://listserver.ebi.ac.uk/mailman/...o/velvet-users

[Tong.W]

I have never seen the source code ,but i have used it many times. Assembly is a very complete work. There are lots of aspects you need to take into account. I know that in SOAPdenovo when construct scaffold last step ,the contig will be cut K bp length which K means the setting kmer length.

[F-flow]

Wizard50 > The layout script was removed in version V 1.0.19: https://github.com/dzerbino/velvet/b...ster/ChangeLog. I do not know why. You can still get Velvet (and layout) version 1.0.18 from http://www.ebi.ac.uk/~zerbino/velvet/velvet_1.0.18.tgz .

[F-flow]

This is the commit when layout was removed: https://github.com/dzerbino/velvet/c...aaa4204653a292