convert to fasta format on "windows"

[me91]

Hi,
I need a software compatible with windows which converts files with fastq format to fasta format.
I searched forum and found some code or softwares just for linux.
Thank you for any advice.

[GenoMax]

You can visit http://usegalaxy.org and use the "fastq to fasta converter" tool under the "NGS:QC and manipulation" category. You will need to upload your files to galaxy.

You could use a live CD of biolinux (http://nebc.nerc.ac.uk/tools/bio-linux) but the above option would be the most simple.

[me91]

i had several .sra files with size near to 1GB when converted to fastq their size increased to 4GB, so uploading them takes a long time and is impossible.

[xied75]

Show me a sample fastq and the fasta you want, I can give you a script if you run PowerShell; or if you are ok with CMD, I can compile a C# program for you.

Best,

dong

[me91]

The format (fastq) looks something like this:

@HWI-962:55:C0A4UACXX:4:1101:1375:2341 1:N:0:TCTCAG
GTCACTGATCGGGGAATTCGTACAGTCTCGTATATGTGAGTCAATGCGTCGTNGCTCCCCTTAACG
TACGTGCAATCTTGTCGGTTCGGCGGCACAAAA
+
B?BDFDDFHHHHHJJJDHHIEFGGGCGBFF6DFH@HBFHI9B@FDHIJBHH;#-5;CHFF;@@CED?BBD(5AACDACDDCCDD59@@BBBDB-9ABDB


and output fasta file format is not important. just standard one to work with it in bowtie or mega is ok.

[me91]

fastq file is exactly like this :

@SRR017963.1 HWI-EAS153_5_30KE6AAXX:2:1:105:2042 length=76
GTNNNTTNTTCTTGTGNTTTGAATTTAACCATGGAAGACAGTGATGGTGTAACTTATGCATTAAAGTGTGACAGTA
+SRR017963.1 HWI-EAS153_5_30KE6AAXX:2:1:105:2042 length=76
:6!!!::!::::::::!:::::::::::::7777711131311331131111/13111101013/0/0111111/0
@SRR017963.2 HWI-EAS153_5_30KE6AAXX:2:1:172:1564 length=76
GTAAGGGCATGCAAGACACACTGAGCTGCCGTAGGCACCGGGGGCCCGAGAATGGTGAGCAGGCGGGCCGGAAGCC
+SRR017963.2 HWI-EAS153_5_30KE6AAXX:2:1:172:1564 length=76
:&52&,*&-6655166:.(&31*3(&53:.&,20+/++/'(&.'$&('+0%/(-&%(&0$$-'&+&+(-''$)-&$

[maubp]

You should be able to install Perl or Python on your Windows machine. This kind of conversion is just two lines of Python with Biopython (using the Bio.SeqIO.convert function).

[me91]

You should be able to install Perl or Python on your Windows machine. This kind of conversion is just two lines of Python with Biopython (using the Bio.SeqIO.convert function).

i have installed python and when use these commands to convert no output data creates.

from Bio import SeqIO
SeqIO.convert("C:\Python27\SRR017963.fastq", "fastq", "C:\Python27\out.fasta", "fasta")

[maubp]

i have installed python and when use these commands to convert no output data creates.

Did you install Biopython too? Which version (although any recent version should be OK with this example)? Was there any output to screen - for example an error message?

The only thing I would suggest is to beware of slashes in strings. Python (and C and many other programming languages) treat slash as an escape character, for example \n means new line and \t means tab. Therefore you'd have to use \\ for just \ or in Python prefix the string with an 'r' for 'raw' mode (no slash escaping). i.e.

from Bio import SeqIO
count = SeqIO.convert(r"C:\Python27\SRR017963.fastq", "fastq", r"C:\Python27\out.fasta", "fasta")
print "Converted %i records" % count

[me91]

Thank you peter.
It worked! i think it was just because i wrote the whole code and then executed them so i could not see error messages.

[xied75]

.NET Bio solution here:

1, go to http://bio.codeplex.com/ download and install .NET Bio 1.01.
2, from Start -> All Programs -> .NET Bio -> .NET Bio Command Prompt
3, change directory to where your fastq is, then type

 FileFormatConverter.exe example.fastq example.fasta

[me91]

.NET Bio solution here:

1, go to http://bio.codeplex.com/ download and install .NET Bio 1.01.
2, from Start -> All Programs -> .NET Bio -> .NET Bio Command Prompt
3, change directory to where your fastq is, then type

 FileFormatConverter.exe example.fastq example.fasta

thanks for your solution. sounds a quick way to format conversions and do assemblies.

[maubp]

I forgot to mention EMBOSS seqret:

http://emboss.open-bio.org/wiki/Appdoc:Seqret

The open source EMBOSS suite is written in C, and is available for all the main operating systems (including Windows).