Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • noms
    Junior Member
    • Apr 2012
    • 7

    #1

    Weird Seg Fault in Bedtools

    I'm getting a Seg Fault using genomeCoverageBed from the BEDtools package and I'm running out of ideas about what the cause is.

    I have narrowed down the problem to a couple of reads in my SAM file, before I convert it into BAM and index it.

    Code:
    @SQ     SN:chr21        LN:46944323
    TUPAC_0006:1:52:2620:5624#0     99      chr21   0       255     4I72M   =       18852856        142     TTATTTAAGTATTCAACTTTGTCCAAAGGATGTAGACNTGTATTAGGAGACATAATAAAATATTATCAATAATAAT    gggeggggggggggcgggggggggdgggggfggggdeBee`deedgcfgggggaegegeggeegggggggfeggcg    NH:i:1  HI:i:1  AS:i:149        nM:i:0  jM:B:c,-1
    TUPAC_0006:2:27:16247:2980#0    99      chr21   0       255     4I72M   =       18852856        142     TTATTTAAGTATTCAACTTTGTCCAAAGGATGTAGACCTGTATTAGGAGACATAATAAAATATTATCAATAATAAT    Yggfgc`fffgfadfggggggggfgdf]fffffffccdee]Wfffggagcdca_f_faccf`cafggggcfdfd[f    NH:i:1  HI:i:1  AS:i:150        nM:i:0  jM:B:c,-1
    I'm running the following command when it seg faults

    Code:
    genomeCoverageBed -split -strand + -bg -ibam chr21_maternal.other.sort.bam -g hg18.txt > chr21_maternal.otherp.wig
    And the code doesn't seg fault when only one of these reads are analyzed.
    Any ideas about what is going on? Has anyone ever come across this problem before?

    Thanks!
  • noms
    Junior Member
    • Apr 2012
    • 7

    #2
    Nevermind. Just realized that the starting position is zero.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 08-13-2026, 12:22 PM
    0 responses
    21 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-11-2026, 10:35 AM
    0 responses
    18 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-06-2026, 07:41 AM
    0 responses
    33 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    51 views
    0 reactions
    Last Post SEQadmin2  
    Working...