Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Split fastq file with renaming reads

    Hi

    I am trying to split fastq file to one read per file seperately and rename the read name. For example

    Code:
    @HBGAIY001A
    TGTCTCAACTAATTTAGCCGCAGACCAAGTCTCTGCTACCGT
    +HBGAIY001A
    III???HIHG<<???EEEEE?BBF9999?EEEF>@@AEAA?999:=II
    @HBGAIY001A
    GGAACATGAACAGACCAAGTCTCTGCTACCG
    +HBGAIY001A
    4400/67766724/0088??AAAA???FFFFFFFC
    The above is example for two reads and i have big file with reads. Now i wanted to make them in to seperate file i.e here two files and rename the read name. After that it should be like this

    File 1:

    Code:
    @Sample1_HBGAIY001A
    TGTCTCAACTAATTTAGCCGCAGACCAAGTCTCTGCTACCGT
    +Sample1_HBGAIY001A
    III???HIHG<<???EEEEE?BBF9999?EEEF>@@AEAA?999:=II
    File 2:
    Code:
    @Sample1_HBGAIY001A
    GGAACATGAACAGACCAAGTCTCTGCTACCG
    +Sample1_HBGAIY001A
    4400/67766724/0088??AAAA???FFFFFFFC

  • #2
    You need to learn a scripting language: bash, perl ,python or a higher level language C,C++,java. Meeting your specification is trivial using these tools.
    I'd recommend figuring out bash and the standard UNIX utilities (sed/grep/awk/tr) because if you succeed, your going to need them for de-complicating your life.

    But ...
    You don't want to do what you are suggesting. Fastq files are very large. I mean ... MUCHO GRANDE ... HUGEMONGOS number of records. Imagine creating a file for every record. Result: too many files. It's damn near impossible to manage tens of thousands of files. Even listing the files just to see what's in a directory becomes very difficult. Are you going to scroll for 9 minutes trying to find a record?

    There's probably better paths to reaching your goal.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    15 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    21 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    16 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    45 views
    0 likes
    Last Post seqadmin  
    Working...
    X