Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • BWA conflicting flags

    Hi!
    I have a problem, and haven't found a solution for it, maybe someone in here might be able to help me. I have some hiseq reads and was mapping them against a genome with BWA. After the mapping I looked at the SAM file and found this

    504740071024319674 77 * 0 0 * * 0 0 AGATGGAAAACAAAAAAAACTCATAGGGACTTCGTCCTCTCATAAAAAACTTGGGGAAACCATAATAAGCTTGTGTAGGGTTCTTGGAGTCCAATATGACA IIIIIIIIIIIIIIIIIIIIIIIHIHHIIHIIIIHIIHIIIHIIHIIHHFIIIHHIGHHGHHHHHHHGHGGGHDHBEEEE@EEFECBCEBD@DDEEEED=B
    504740071024319674 181 scaffold_3|24390584|24400594 2165 0 * = 2165 0 AGCCATAATAAGCTTGTGTAGGGTTCTTGGAGTCCAATATGAGAAGATTGGTGTGTATGACTGAGTATAAGAAAGGGAAATGCAACCCGGATCCTGATTGC ##?<BBABBBABDADDDEDEGECBBB8GGGGCBEDEGEHBGHGGHHHCGHHGHHIHIIIHIFIIIIIIIGGIHHIIIIIIHIIHHIIIIIIHHIIIIIIII

    So, the second column of each line (the FLAG field) seem to be conflicting, 77 1+4+8+84 which is both reads unmapped, the second one is 181 1+4+16+32+128 whcih means 1 red is unmapped and one isn't. Anyone have an idea of that is happening here?
    Thank you!

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-13-2024, 08:58 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
185 views
0 likes
Last Post seqadmin  
Working...
X