Originally posted by fkrueger
View Post
Unconfigured Ad
Collapse
X
-
Please help! (Trim Galore of RRBS data)
Hi!
I want to use Trim Galore to precess RRBS data before working with bismark.
System win7 ultimate, 64bit
However, I get the following error message:
Traceback (most recent call last):
File "F:\RRBSCML\cutadapt\scripts\cutadapt.py", line 71, in <module> from cutadapt import seqio, __version__
ImportError: cannot import name seqio
What am I doing wrong?
Thanks for help!!
Comment
-
Hi magisterh,
The error you are seeing is caused by Cutadapt not being able to find required packages under Windows. I would suggest to either contact Marcel Martin directly (the developer of Cutadapt), or follow BB's suggestion to use his suite of tools.
Comment
-
trim galore and cutadapt software errors
hi...
this is the error i am getting while running the Trim galore and cutadapt... what is the exactly this error, and how can solve this problem ????
cutadapt/_align.c:8:22: fatal error: pyconfig.h: No such file or directory
#include "pyconfig.h"
^
compilation terminated.
error: command 'x86_64-linux-gnu-gcc' failed with exit status 1
----------------------------------------
Cleaning up...
Command /usr/bin/python -c "import setuptools, tokenize;__file__='/tmp/pip_build_manman/cutadapt/setup.py';exec(compile(getattr(tokenize, 'open', open)(__file__).read().replace('\r\n', '\n'), __file__, 'exec'))" install --record /tmp/pip-V_zM1D-record/install-record.txt --single-version-externally-managed --compile failed with error code 1 in /tmp/pip_build_manman/cutadapt
Storing debug log for failure in /home/manman/.pip/pip.log
Comment
-
hi ....Originally posted by JQL View PostHi
I try to run trim galore but received an error message (pasted below). It says "cutadapt ... failed at /usr/local/bin/trim_galore line 420". Anyone knows what it means?
thanks
###############################
$ No quality encoding type selected. Assuming that the data provided uses Sanger encoded Phred scores (default)
SUMMARISING RUN PARAMETERS
==========================
Input filename: Sample_C1.R1.fastq.gz
Quality Phred score cutoff: 20
Quality encoding type selected: ASCII+33
Adapter sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG'
Maximum trimming error rate: 0.1 (default)
Minimum required adapter overlap (stringency): 20 bp
Minimum required sequence length before a sequence gets removed: 20 bp
Running FastQC on the data once trimming has completed
Running FastQC with the following extra arguments: '--outdir ./'
Output file will be GZIP compressed
Writing final adapter and quality trimmed output to Sample_C1.R1_trimmed.fq
>>> Now performing quality (cutoff 20) and adapter trimming in a single pass for the adapter sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG' from file Sample_C1.R1.fastq.gz <<<
open3: exec of cutadapt -f fastq -e 0.1 -q 20 -O 20 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG Sample_C1.R1.fastq.gz failed at /usr/local/bin/trim_galore line 420
RUN STATISTICS FOR INPUT FILE: Sample_C1.R1.fastq.gz
=============================================
0 sequences processed in total
Illegal division by zero at /usr/local/bin/trim_galore line 506.
^C
[3]- Exit 255 trim_galore --fastqc_args "--outdir ./" -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -s 20 Sample_C1.R1.fastq.gz
i am also getting the same error ... please can tell me how did you try to solve this problem ????
Comment
-
Hi everyone, does anyone know how to fix this trim galore/cutadapt error:
SUMMARISING RUN PARAMETERS
==========================
Input filename: paired
Trimming mode: single-end
Trim Galore version: 0.3.7
Quality Phred score cutoff: 20
Quality encoding type selected: ASCII+33
Adapter sequence: 'AGATCGGAAGAGC'
Maximum trimming error rate: 0.1 (default)
Minimum required adapter overlap (stringency): 1 bp
Minimum required sequence length before a sequence gets removed: 20 bp
Writing final adapter and quality trimmed output to paired_trimmed.fq
>>> Now performing quality (cutoff 20) and adapter trimming in a single pass for the adapter sequence: 'AGATCGGAAGAGC' from file paired <<<
'import site' failed; use -v for traceback
Traceback (most recent call last):
File "/jhpce/shared/community/compiler/gcc/4.4.7/python/3.4.0/lib/python3.4/encodings/__init__.py", line 31, in <module>
import codecs
File "/jhpce/shared/community/compiler/gcc/4.4.7/python/3.4.0/lib/python3.4/codecs.py", line 88
*, _is_text_encoding=None):
^
SyntaxError: invalid syntax
Cutadapt terminated with exit signal: '256'.
Terminating Trim Galore run, please check error message(s) to get an idea what went wrong...
Yet codecs is part of my available python modules!
Comment
-
Hi Varenka,
not quite sure what is going wrong exactly but you need to get Cutadapt up and running before using Trim Galore. If you enter
you should see the Cutadapt help, does that work? If you run FastQC on your input file ('paired'), does that run to completion? This should tell you if something is wrong with the input file. Other than that... hmm, try reinstalling Cutadapt following their exact installation guidelines?Code:$ cutadapt
Comment
Latest Articles
Collapse
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
07-31-2026, 11:01 AM -
-
by SEQadmin2
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...-
Channel: Articles
07-20-2026, 11:48 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 08-06-2026, 07:41 AM
|
0 responses
23 views
0 reactions
|
Last Post
by SEQadmin2
08-06-2026, 07:41 AM
|
||
|
Started by SEQadmin2, 08-03-2026, 10:13 AM
|
0 responses
37 views
0 reactions
|
Last Post
by SEQadmin2
08-03-2026, 10:13 AM
|
||
|
Started by SEQadmin2, 07-31-2026, 02:55 AM
|
0 responses
43 views
0 reactions
|
Last Post
by SEQadmin2
07-31-2026, 02:55 AM
|
||
|
Started by SEQadmin2, 07-24-2026, 12:17 PM
|
0 responses
26 views
0 reactions
|
Last Post
by SEQadmin2
07-24-2026, 12:17 PM
|
Comment