Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • EGrassi
    Member
    • Oct 2010
    • 66

    htseq-count eats 42G of memory

    Hello,

    I've been using DESeq for a while and right now htseq-count (version 0.5.3p9) it's giving me problems with a bam file (smaller than other that I've used with the same options and the same gtf), it runs and keeps occupying more memory, fills it and then start swapping, this is the relevant top output:
    Code:
    2958 data      20   0 46.5g  46g  676 D    6 97.5 841:10.30 htseq-count
    Any idea? Thanks!
  • Simon Anders
    Senior Member
    • Feb 2010
    • 995

    #2
    How have you called htseq-count? Please post the precise command line, and any output generated.

    Comment

    • EGrassi
      Member
      • Oct 2010
      • 66

      #3
      Thank you for you answer:

      Code:
      samtools sort -n /rogue/bioinfotree/task/RNAseq/dataset/0.1/GSE27003/alignment_tophat/SRR097789.merged.bam SRR097789_sorted  
      samtools view SRR097789_sorted.bam | htseq-count -m intersection-nonempty --stranded=no - annotation.gtf > nonoverlap_nonempty_counts_SRR097789_htseq 2> nonoverlap_nonempty_counts_SRR097789_htseq.err
      No output reported, just the processing of the gtf infos.
      I've manually inspected the bam file and it seems to have a lot of missing read ids (? I got the data from sra and just dumped it to fastq files, and they seem ok to me. Then standard tophat pipeline...), so now I'm trying to filter them out to see if that's the cause of the problem.
      Samtools flagstat on the bam file does not report anything wrong with the bam file itself, apart from a very log percentage of properly paired reads.

      Comment

      • Simon Anders
        Senior Member
        • Feb 2010
        • 995

        #4
        Htseq-count starts with reading in the annotation file and reports when its finished with that before looking at the reads. So, if it prints nothing, your problem is with the GTF file. How does it look like?

        Comment

        • EGrassi
          Member
          • Oct 2010
          • 66

          #5
          Sorry, I did not point out htat properly maybe: "No output reported, just the processing of the gtf infos."
          It finished the processing of the gtf, if you want the number I have to rerun it...but I swear that it printed them and that the same gtf worked with other bam files.
          Last edited by EGrassi; 10-10-2012, 05:31 AM.

          Comment

          • EGrassi
            Member
            • Oct 2010
            • 66

            #6
            Ok, I tried removing from the .sam files lines with an empty read name (I hope to understand why they're there) and it finished without any problem, the counts seems sensible to me (not from a biological point of view, ok, but they are numbers and sometimes they are different from 0!). If you want a sample of the .bam/.sam files with those strange lines I can give them to you (although I do not know if they are out of the bam format standard and samtools is just being nice to them or if they are ok and this could be a small bug of htseq_count/the library that it uses to scan bam files).

            Comment

            • EGrassi
              Member
              • Oct 2010
              • 66

              #7
              ...because of tophat?

              Ok, as long as fastq seems fine to me (they have an id foreach read, for example) I'm starting to think that the strange bam/sam obtained are tophat's responsibility.

              I have "normal" lines like these ones:
              Code:
              SRR097789.29777200      89      chr19   55899346        255     50M     *       0       0       ATGCTCGCGCCNCGNTCAGCAGCATCAGACACATGATCCGCAAGAACAAG      AHFH@44455-!5-!:A:A:DHHHHHHHHHH=HEHDDDHDHHHHFFEGFG      AS:i:-2 XN:i:0  XM:i:2  XO:i:0  XG:i:0  NM:i:2  MD:Z:11A2C35    YT:Z:UU XS:A:+  NH:i:1
              And others without the QNAME field:

              Code:
                     329     chr1    10005   0       50M     *       0       0       CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
                    *       AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UU NH:i:20 CC:Z:chr5       CP:i:10131      HI:i:0
              Sequences gotten from lines like this one are found in the fastq files, associated with IDs.

              Does anyone have an idea? I'm using tophat 2.0 with this command line:
              Code:
              tophat -p 7 --no-novel-juncs -G /rogue/bioinfotree/prj/ewing-rnaseq/local/share/data/Homo_sapiens/UCSC/hg19/Annotation/Genes/genes.gtf --transcriptome-index=transcriptome -o SRR097789.th ../alignment/expanded_genome2 <(zcat /rogue/bioinfotree/task/RNAseq/dataset/0.1/GSE27003/reads//SRR097789_1.fastq.gz) <(zcat /rogue/bioinfotree/task/RNAseq/dataset/0.1/GSE27003/reads//SRR097789_2.fastq.gz)
              The --no-novel-juncs option had to be added otherwise it will just freeze and stop after a while (see this other thread: http://seqanswers.com/forums/showthread.php?t=23887)

              Comment

              • jyuert
                Junior Member
                • Jun 2022
                • 1

                #8
                I read that Post and got it fine and informative. stick merge

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                  by SEQadmin2


                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                  The systematic characterization of the human proteome has
                  ...
                  07-20-2026, 11:48 AM
                • SEQadmin2
                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                  by SEQadmin2



                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                  ...
                  07-09-2026, 11:10 AM
                • SEQadmin2
                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                  by SEQadmin2



                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                  07-08-2026, 05:17 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, 07-24-2026, 12:17 PM
                0 responses
                30 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-23-2026, 11:41 AM
                0 responses
                23 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-20-2026, 11:10 AM
                0 responses
                213 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-13-2026, 10:26 AM
                0 responses
                79 views
                0 reactions
                Last Post SEQadmin2  
                Working...