Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problematic Fastq qualities with BWA

    Hi all,

    I'm having problems running BWA (0.5.9-r16 and 0.6.2) on some new whole exome data.

    The initial alignment runs fine (it seems) but when I want to create a SAM file with 'bwa sampe' it screws up the quality scores. Reading the file with samtools gives this error:
    [samopen] SAM header is present: 25 sequences.
    Parse error at line 27: sequence and quality are inconsistent
    This is the first sequence line of the SAM file:
    HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 60 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG ^_^_$^]^SESC ^\ ^Y# ^_^V^\^W $"#$!#" ^^
    ^X^^
    Compared to an equivalent output from bowtie2:
    @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta7
    HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 42 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG >>C<2;(8B?>5;6(?CABC@BA?=)7=)7;CIIHEHIGIGC=?BD<@GE>GBB3DEF9AIIIIIGGGGHF?D6E9DHGHCHCBIFF<>FHDDB=:;?1 AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP
    Anyone else seen this? Is this a problem caused by an incompatibility between BWA and casava 1.8+? I've run BWA in the past with no problems.
    TIA

  • #2
    Bump. Am I the only one seeing this?

    Comment


    • #3
      I had similar issues with bwa, switched to bowtie2 like you did

      Comment


      • #4
        Please write down the command line of BWA. Not just the sampe part, but the aln part also. Usually I get this kind of results when I use -I option in bwa aln.
        Other tip: See the next line after the error (in your case line 28). Maybe a newline character can be found on your quality score?

        Comment


        • #5
          I thought this was a dead thread so didn't update.

          Problem is/was the '-I' switch in bwa. It doesn't work with newer sanger fastq format files produced with Illumina pipeline v1.8+: remove switch and it works.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Recent Advances in Sequencing Analysis Tools
            by seqadmin


            The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
            05-06-2024, 07:48 AM
          • seqadmin
            Essential Discoveries and Tools in Epitranscriptomics
            by seqadmin




            The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
            04-22-2024, 07:01 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 05-14-2024, 07:03 AM
          0 responses
          20 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-10-2024, 06:35 AM
          0 responses
          44 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-09-2024, 02:46 PM
          0 responses
          54 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-07-2024, 06:57 AM
          0 responses
          43 views
          0 likes
          Last Post seqadmin  
          Working...
          X