Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • chris
    replied
    I thought this was a dead thread so didn't update.

    Problem is/was the '-I' switch in bwa. It doesn't work with newer sanger fastq format files produced with Illumina pipeline v1.8+: remove switch and it works.

    Leave a comment:


  • TiborNagy
    replied
    Please write down the command line of BWA. Not just the sampe part, but the aln part also. Usually I get this kind of results when I use -I option in bwa aln.
    Other tip: See the next line after the error (in your case line 28). Maybe a newline character can be found on your quality score?

    Leave a comment:


  • desaila
    replied
    I had similar issues with bwa, switched to bowtie2 like you did

    Leave a comment:


  • chris
    replied
    Bump. Am I the only one seeing this?

    Leave a comment:


  • chris
    started a topic Problematic Fastq qualities with BWA

    Problematic Fastq qualities with BWA

    Hi all,

    I'm having problems running BWA (0.5.9-r16 and 0.6.2) on some new whole exome data.

    The initial alignment runs fine (it seems) but when I want to create a SAM file with 'bwa sampe' it screws up the quality scores. Reading the file with samtools gives this error:
    [samopen] SAM header is present: 25 sequences.
    Parse error at line 27: sequence and quality are inconsistent
    This is the first sequence line of the SAM file:
    HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 60 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG ^_^_$^]^SESC ^\ ^Y# ^_^V^\^W $"#$!#" ^^
    ^X^^
    Compared to an equivalent output from bowtie2:
    @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta7
    HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 42 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG >>C<2;(8B?>5;6(?CABC@BA?=)7=)7;CIIHEHIGIGC=?BD<@GE>GBB3DEF9AIIIIIGGGGHF?D6E9DHGHCHCBIFF<>FHDDB=:;?1 AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP
    Anyone else seen this? Is this a problem caused by an incompatibility between BWA and casava 1.8+? I've run BWA in the past with no problems.
    TIA

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
24 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
19 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
50 views
0 likes
Last Post seqadmin  
Working...
X