I thought this was a dead thread so didn't update.
Problem is/was the '-I' switch in bwa. It doesn't work with newer sanger fastq format files produced with Illumina pipeline v1.8+: remove switch and it works.
-
Please write down the command line of BWA. Not just the sampe part, but the aln part also. Usually I get this kind of results when I use -I option in bwa aln.
Other tip: See the next line after the error (in your case line 28). Maybe a newline character can be found on your quality score?Leave a comment:
-
Problematic Fastq qualities with BWA
Hi all,
I'm having problems running BWA (0.5.9-r16 and 0.6.2) on some new whole exome data.
The initial alignment runs fine (it seems) but when I want to create a SAM file with 'bwa sampe' it screws up the quality scores. Reading the file with samtools gives this error:
This is the first sequence line of the SAM file:[samopen] SAM header is present: 25 sequences.
Parse error at line 27: sequence and quality are inconsistent
Compared to an equivalent output from bowtie2:HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 60 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG ^_^_$^]^SESC ^\ ^Y# ^_^V^\^W $"#$!#" ^^
^X^^
Anyone else seen this? Is this a problem caused by an incompatibility between BWA and casava 1.8+? I've run BWA in the past with no problems.@PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta7
HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 42 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG >>C<2
;(8B?>5;6([email protected]?=)7=)7;CIIHEHIGIGC=?BD<@GE>GBB3DEF9AIIIIIGGGGHF?D6E9DHGHCHCBIFF<>FHDDB=:;?1 AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP
TIA
-
In the first segment of our review of epigenetic sequencing methods, we covered methylation detection, chromatin accessibility, and protein-DNA interactions. This final part of our review will break outside of the standard analysis and cover some influential multidimensional methods.
Spatial Epigenomics
“Epigenetic assays, whether conducted at the single-cell or bulk level, have played a crucial role in unraveling the underlying mechanisms of diseases and...Yesterday, 06:48 AM -
Developments in sequencing technologies and methodologies have transformed the field of epigenetics, giving researchers a better way to understand the complex world of gene regulation and heritable modifications. This article explores some of the diverse sequencing methods employed in the study of epigenetics, ranging from classic techniques to cutting-edge innovations while providing a brief overview of their processes, applications, and advances.
Methylation Detect...05-31-2023, 10:46 AM -
Differential Expression and Data Visualization: Recommended Tools for Next-Level Sequencing Analysis
After covering QC and alignment tools in the first segment and variant analysis and genome assembly in the second segment, we’re wrapping up with a discussion about tools for differential gene expression analysis and data visualization. In this article, we include recommendations from the following experts: Dr. Mark Ziemann, Senior Lecturer in Biotechnology and Bioinformatics, Deakin University; Dr. Medhat Mahmoud Postdoctoral Research Fellow at Baylor College of Medicine;...05-23-2023, 12:26 PM
Leave a comment: