Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Hilary April Smith
    Member
    • Jul 2011
    • 22

    #1

    Trimmomatic Help Single Reads Error

    Hi. I just came across/downloaded the trimmomatic program, but in trying to use it to trim my single reads I am obtaining the errors below. I created a fasta file with my adapters (named as >Universal etc., with the full TruSeq adapter sequences). It seems the program is reading the adapter sequences and starts, but then I receive the errors about the fastq header. I can change the fastq line if I know what it should look like, but I can't discern the format required. (As it is I've had to do some manual adjustments; the sequencing facility gave me separate fastq files for the barcode/index and seq. read files ... without modification my fastq name actually ends in 2:N:0. Note also the last sequence is just my addition of a partial adapter read to make sure Trimmomatic kills it). My short test input file, and the error message, are below. Any help is greatly appreciated!!!


    @JLK5VL1:2351BE1ACXX:6:1101:1465:2207 1:N:0:CTTGTA
    CTTGTAAGCTGGCTTTAATCGCATCGCTTGAACTTTTTCGCCGACCAGACACACAAATGAATACAGCCCCCTCCGTTTTGACTTGCGCCCCCATCAGAGAGACCAACA
    +
    @@@DD;DBC@FFFFFHFFHHGJJJJJJFHHGCFHJJJJFFIIJJJBH(BCHEGHEHHEEFE;CEF>@A=?B?BD=ACDB?<ACDCC>BBDDDBCDDCDD@<??<CDD@
    @JLK5VL1:2351BE1ACXX:6:1101:1518:2135 1:N:0:CTTGTA
    CTTGTAATTTTTTGGTGCGTTTGTTTTTCACAACTGTGTTTTCATATTTCCCTATTTCCCTTGTTCTATTTCCGTTCGACTAGCGCACAGGTAGAAAGTGTTATTTTC
    +
    @BCFFADBCCFFFDFFHHHHGGIGIIIHIIIJIIIICEGEHIGIIGIIJIIJIGIIHDGIGHHFGHHJJIJG@EHHFEFDDCEDDBDD@?A>:ACCA>>AC@CCCD@:
    @JLK5VL1:2351BE1ACXX:6:1101:1676:2243 1:N:0:CTTGTA
    CTTGTAACTGTAACCAACTACTACCATTCGCAAGCAATTTCGAGCGAGATGGGTGTATACTTAATACAGACAGACCGTGAGTTGGGATCACACGGCGATGAGCATTCA
    +
    ??1=?4:?@@AAB>B<FDFBFGFG?<FHIIDBGEGC3CFFD?CFIAE<DADFB8;5=F>;C)=4=@CFEEF@3?BDC>??@A@BB@@BBBB>><<9>>5-::>@AABA
    @JLK5VL1:2351BE1ACXX:6:1101:1767:2179 1:N:0:CTTGTA
    CTTGTAACAACGATCGTATCCTTCGACCGAAACGGTTTAAGCTTTGCTGAAGTAGGTTTTACCCACAGGTTACAGCTGCACTACGCCAACGAACGAAACACTCGACTA
    +
    @B<DBDD@@@FDDFFFHHGHIIIII<FIGGGEIIIEHHCHBBFGGIIDGFEG@@E@CDHEAAEEEFFFD>CEEEDDDDDDCCCC?:@DDDB<BB<BDB>C@(>?2529
    @JLK5VL1:2351BE1ACXX:6:1101:2314:2166 1:N:0:CTTGTA
    CTTGTAAGATAAGTGCACGGCAATTGCTAGTTTACCGCTGAATATCGCCGCCCGGATCATTGAGTTCAACGGGTTTGTACCCCTAGGCAGTTTCACGTACTATTTGAC
    +
    @B@DDDDBCCFFFDFHHHHHJJJJJJJJIJIJJJJJJJJJJIIGIIJJJFIJJJHEFFFEECCCEDDDEDDDDDDDDDEEDDDDDDDDDDDCEDEDBBDDD<CDECD@
    @JLK5VL1:2351BE1ACXX:6:1101:2345:2192 1:N:0:CTTGTA
    CTTGTAACTGGCACAGATCTTGGTGGTAGTAGCAAATATTCGAACGAGCTCTTGGATGACTGAAGTGGAGAAGGGTTTCGTGTCAACAGCAGTTGAACACGAGTTAGC
    +
    BC@FFFFCCCFFFFFHHHHHJJJEGIHIJHJJIJJJJIIIIIIJJJGIJJJJJJJFEGGIJDCGIFFIBHGHJHH=ABDDECDEEEDDDDCBDDCDDCDDBBDB(:@C
    @JLK5VL1:2351BE1ACXX:6:1101:2311:1710 1:N:0:CTTGTA
    AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
    +
    BC@FFFCCCFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

    $ java -classpath trimmomatic-0.22.jar org.usadellab.trimmomatic.TrimmomaticSE -phred33 -trimlog trimlogfile.txt head_rnaseq3_BC11.fastq test1.fastq ILLUMINACLIP:Adapters.fasta:2:40:15 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
    TrimmomaticSE: Started with arguments: -phred33 -trimlog trimlogfile.txt head_rnaseq3_BC11.fastq test1.fastq ILLUMINACLIP:Adapters.fasta:2:40:15 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
    Using Clipping Sequence: 'CTAGCCTT ##... (it goes on for all 36 adapter lines, where I gave it sequences for each adapter in the forward, reverse, complement, and rev complement direction. This part looks fine, but then):

    ILLUMINACLIP: Using 0 prefix pairs, 36 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Exception in thread "main" java.lang.RuntimeException: Invalid FASTQ name line:
    at org.usadellab.trimmomatic.fastq.FastqParser.parseOne(FastqParser.java:51)
    at org.usadellab.trimmomatic.fastq.FastqParser.next(FastqParser.java:105)
    at org.usadellab.trimmomatic.TrimmomaticSE.processSingleThreaded(TrimmomaticSE.java:55)
    at org.usadellab.trimmomatic.TrimmomaticSE.process(TrimmomaticSE.java:197)
    at org.usadellab.trimmomatic.TrimmomaticSE.main(TrimmomaticSE.java:262)
  • Hilary April Smith
    Member
    • Jul 2011
    • 22

    #2
    Hi. Nevermind; I think I may have fixed this...

    Comment

    • tonybolger
      Senior Member
      • Feb 2010
      • 156

      #3
      At a guess, i'd say you have a blank line somewhere in your file, quite likely an extra black line at the end.

      If you do a line count using wc -l, you should see a count which is evenly divisible by 4.

      Comment

      • Hilary April Smith
        Member
        • Jul 2011
        • 22

        #4
        Yes. I am running it now on my full fastq files and from what I've seen so far, it seems to be working great! It's fantastic to have such an efficient tool for trimming adapters and quality filtering. Thank you.

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          How Immunogenomics Decodes Immunity’s Genetic Blueprint
          by SEQadmin2




          The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

          This convergence of genetics, immunology, and computation...
          Yesterday, 05:41 AM
        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 08-24-2026, 10:32 AM
        0 responses
        44 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-20-2026, 11:17 AM
        0 responses
        48 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-18-2026, 10:05 AM
        0 responses
        55 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-13-2026, 12:22 PM
        0 responses
        50 views
        0 reactions
        Last Post SEQadmin2  
        Working...