Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • convert sorted bam to sorted sam for htseq-count

    Hi there,

    I have a bowtie2 alignment of PE non-stranded RNA-seq reads from a bacterial species (used option -k 1; 96.20% pairs aligned concordantly exactly 1 time) , and would like to use htseq-count to get count data across genes. I am having trouble retaining reads sorted after converting a sorted bam to sam format (htseq-count needs sorted sam for PE reads).

    These are my attempts and error messages:

    # sorting reads
    $ samtools sort myalignment.bam myalignment.sorted

    # convert back to sam
    $ samtools view -h myalignment.sorted.bam > out.sorted.sam

    # check (truncated output) - note @HD line 'unsorted', ?
    $ head out.sorted.sam
    @HD VN:1.0 SO:unsorted
    @SQ SN:NC_017656.1 LN:5212843
    @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta7
    HWUSI-EAS1615L:13:FC64RB1AAXX:4:23:7604:14541_1 99 NC_017656.1 156 255 68M = 206 118 CAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCA IIIIIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIHGIIIIGHIIHIHH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:68 YS:i:0 YT:Z:CP
    HWUSI-EAS1615L:13:FC64RB1AAXX:4:70:9040:11393_1 99 NC_017656.1 164 255 68M = 207 111 TAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATT IIIIFIIIIBHHHIFIIIIIIIIIHIGIHIIIIIFHIIIIBIHGHIGHIHHICIHCHF;FEDEFDEH< AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:68 YS:i:0 YT:Z:CP

    # tried htseq-count (truncated output)
    $ htseq-count -s no -t gene -i ID out.sorted.sam ../reference.gff
    4965 GFF lines processed.
    Warning: Read HWUSI-EAS1615L:13:FC64RB1AAXX:4:23:7604:14541_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
    Warning: Read HWUSI-EAS1615L:13:FC64RB1AAXX:4:70:9040:11393_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
    Warning: Read HWUSI-EAS1615L:13:FC64RB1AAXX:4:62:8731:7335_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)


    Your insight is much appreciated!

  • #2
    I think I figured it out. Bowtie2 outputs by default reads sorted by name. The offending part in the reads is the _1, _2 at the end. Removing those (in vim) fixed the problem and htseq-count works without any sorting needed. Only after couple hours of staring at the reads to figure this out, came across this thread that explains an identical issue. Feeling slow...

    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc


    thanks

    Comment


    • #3
      Simple curiosity (since I've also done RNA-seq on some bacterial species), why have you chosen to do your study with paired-end sequencing?

      TP

      Comment


      • #4
        To align reads with greater confidence, as these strains have many phages and IS elements ( some of which are chromosomal in certain strains and plasmid borne in others ), and their genomes have not been sequenced yet ( so I also sequenced the genomes ).

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          Today, 01:16 PM
        • seqadmin
          Recent Advances in Sequencing Analysis Tools
          by seqadmin


          The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
          05-06-2024, 07:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Today, 07:15 AM
        0 responses
        10 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, Yesterday, 10:28 AM
        0 responses
        15 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, Yesterday, 07:35 AM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-22-2024, 02:06 PM
        0 responses
        8 views
        0 likes
        Last Post seqadmin  
        Working...
        X