Error when calling fusion junctions with MapSplice

ecSeq Bioinformatics

Senior Member

Join Date: May 2012
Posts: 490

Error when calling fusion junctions with MapSplice

11-01-2012, 12:43 AM

We want to compare the results of different tools that call splice junctions using RNA-seq data.

Now, I try to call fusion junctions with MapSplice (1.15.2).

My input reads are 100nt in length and in fastq format.

Example:

Code:

@xxxyyyzzz
AGATGCACTACCACCCAGCCTATCAGGACAGGCCAAGCCTGAGGACAGTGACTGTCACAGAAAAATAGAAACTTGTGGTTCCAGGAAATCCGAGAGGTCT
+
IIHIHIHHIHHIHHGHHFGIGHGGGGIIIHHNKIJKIJELHCJFFGLIMLHLGLIAHBIEGFFDJQDAE>HIJHOIMLHAHGGHMPGHIFEJMDVJBEOM

I'm calling Mapsplice as follows (basically copy and pasted from the MapSpliceManual, just added the --fusion parameter):

Code:

python mapsplice_segments.py -u reads.fq -c [somewhere]/genome/hg19/singleChroms/ -B [somewhere]/genome/bowtie/hg19 -Q fq -X 5 -L 25 --fusion

MapSplice quits with an error:

Code:

[Thu Oct 25 11:24:45 2012] Checking for chromosomes files or directory
[Thu Oct 25 11:24:45 2012] Checking for chromosomes files or directory passed
[Thu Oct 25 11:24:45 2012] Checking for Bowtie index files
[Thu Oct 25 11:24:45 2012] check reads format
[Thu Oct 25 11:24:46 2012] merge paired end reads remove short
[Thu Oct 25 11:24:56 2012] Mapping reads against hg19 with Bowtie
[Thu Oct 25 11:25:13 2012] Converting bowtie mapped to SAM format
[Thu Oct 25 11:25:37 2012] divide reads
[Thu Oct 25 11:25:56 2012] Mapping reads against hg19 with Bowtie
[Thu Oct 25 11:26:50 2012] sort segmentbwt
[Thu Oct 25 11:27:15 2012] reads all chromo sizes
[Thu Oct 25 11:27:20 2012] mapsplice_search
[Thu Oct 25 11:30:06 2012] Aligning spliced reads
[Thu Oct 25 11:46:59 2012] mapsplice_report
error: open bwtmap file mapsplice_out/tmp/unspliced_mapped_segments.sorted error
        [FAILED]
Error: mapsplice_report failed
The file mapspliceout/tmp/unsplicedmapped_segments.sorted exists and is not empty.

When I turn of the --fusion parameter, MapSplice finishes with no errors.

Has anyone an idea, where the problem might be?

ecSeq Bioinformatics is Europe’s leading provider of hands-on bioinformatics workshops and professional data analysis in the field of Next-Generation Sequencing (NGS).

Tags: rna-seq mapsplice error

ecSeq Bioinformatics

Senior Member

Join Date: May 2012

Posts: 490
- Share
- Tweet
#2

11-01-2012, 12:52 AM

I also tried to contact the developer directly (10/25/2012:[email protected]). They haven't answered yet.

ecSeq Bioinformatics is Europe’s leading provider of hands-on bioinformatics workshops and professional data analysis in the field of Next-Generation Sequencing (NGS).
Comment

Previous template Next

From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data

by SEQadmin2

Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...
- Channel: Articles
06-02-2026, 10:05 AM
Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends

by SEQadmin2

With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.

Introduction

Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
- Channel: Articles
05-22-2026, 06:42 AM

Topics	Statistics	Last Post
Sequencing the Two-Toed Sloth Genome Reveals Jumping Genes Tied to Its Extreme Metabolism by SEQadmin2 Started by SEQadmin2, Yesterday, 11:58 AM	0 responses 9 views 0 reactions	Last Post by SEQadmin2 Yesterday, 11:58 AM
A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2 Started by SEQadmin2, 06-05-2026, 10:09 AM	0 responses 25 views 0 reactions	Last Post by SEQadmin2 06-05-2026, 10:09 AM
A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2 Started by SEQadmin2, 06-04-2026, 08:59 AM	0 responses 35 views 0 reactions	Last Post by SEQadmin2 06-04-2026, 08:59 AM
Long-Read RNA Sequencing Uncovers a Hidden Layer of Immune Cell Regulation by SEQadmin2 Started by SEQadmin2, 06-02-2026, 12:03 PM	0 responses 57 views 0 reactions	Last Post by SEQadmin2 06-02-2026, 12:03 PM

Unconfigured Ad

Error when calling fusion junctions with MapSplice

Comment

Latest Articles

ad_right_rmr

News