sam 2 bam conversion error

[DavyK]

Hi all, Just aligned some exome sequencing data for an individual, and when converting from sam to bam I get this error:

samtools view -h -S -b -o 1001-1.bam 1001-1.sam
[samopen] SAM header is present: 84 sequences.
Parse error at line 90: sequence and quality are inconsistent
Abort trap: 6

I looked at line 90 in the sam file:

B02V0ACXX110721:1:1207:10678:69422 141 * 0 0 * * 0 0 GGTTAGGGTTAGAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTAGGGGGTTAGGGTTAG !!#'%'%''%%)(*(
$$'&)"$()**&''#")&% %(&

I noticed there were no alignment coordinates. I checked for a bunch of entries in the samfile within the first 1000 lines. There were no alignment coordinates for any of them. Could it be something to do with my reference? I know this data is good as it has been aligned and analysed by others before me. I have been having trouble aligning other data also. Only thing in common is software and reference (reference downloaded from GATK resource bundle, indexed with bwa index).

Any suggestions are welcome.

Cheers,
Davy

[valei]

generally the sequence length should be equal to the quality string length. In your read you have 76 nucleotides and only 38 character for the quality string....probably there are some problem with you input fastq.

[DNASpeaks]

Hello Everyone,
I am having trouble converting the sam files to bam using samtools. I used this cmd to convert my sam to bam -

samtools view -bT hg19.fa s_chip2.sam > s_chip2.bam
I got this error.
Parse error at line 7707082: sequence and quality are inconsistent
Aborted


I ran ValidateSamFile.jar, a picard tool and got the following error, hundreds of them -

WARNING: Read name HWI-ST798R:82: D18MUACXX:2:1101:2025:1987, A record is missing a read group
ERROR: Record 5, Read name HWI-ST798R:82: D18MUACXX:2:1101:8625:1992, Empty sequence dictionary.

I am not sure how to fix this, any help is appreciated.