Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • secondary alignment and unique hit (NH:i:1)? tophat

    3000 of my single-end reads have the secondary alignment bit turned on (0x100) but they're reported as unique hits (NH:i:1). How is this possible?

    I thought every read with a secondary alignment had to also have a primary alignment, but that's not what I get, for example, grep only returns one result for read WICMT-SOLEXA2_20A62AAXX:5:150:761:975

    Code:
    $ samtools view accepted_hits.bam | grep "WICMT-SOLEXA2_20A62AAXX:5:150:761:975"
    WICMT-SOLEXA2_20A62AAXX:5:150:761:975	272	chr2	133038625	255	4M4I28M	*	0	0	AGACTGACCCATGTTCAACTGCTGTTCACATGGAAC	*	AS:i:-22	XN:i:0	XM:i:1XO:i:1	XG:i:4	NM:i:5	MD:Z:0G31	YT:Z:UU	NH:i:1
    $
    which has the NH:i:1 and the 0x100 (secondary alignment) and 0x10 (reverse strand) flags (0x100+0x10 = 272)

    Any ideas?

  • #2
    Did you run tophat with --report-secondary-alignments on?

    Comment


    • #3
      I didn't, unless that's the default

      Comment


      • #4
        the default is off, i.e "TopHat reports best or primary alignments based on alignment scores (AS)" (http://tophat.cbcb.umd.edu/manual.html)

        Comment


        • #5
          Might have been fixed in Tophat 2.0.2.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Current Approaches to Protein Sequencing
            by seqadmin


            Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
            04-04-2024, 04:25 PM
          • seqadmin
            Strategies for Sequencing Challenging Samples
            by seqadmin


            Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
            03-22-2024, 06:39 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 04-11-2024, 12:08 PM
          0 responses
          31 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 10:19 PM
          0 responses
          33 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 09:21 AM
          0 responses
          28 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-04-2024, 09:00 AM
          0 responses
          53 views
          0 likes
          Last Post seqadmin  
          Working...
          X