Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Merging Pairwise Sequence Alignment

    Dear All,

    I am looking for a way to "merge" two large sequence files. The first sequence is the reference sequence and the second is a consensus sequence containing ambiguous nucleotides (Ns). The merged sequence should correspond to the consensus sequence but the missing nucleotides should be used from the reference.

    Example:

    BAM-consensus: CCCTANNNNNNNNCATCTACATGG
    Reference: GTATAGATATCATCATCTACATCC
    Output => CCCTAGATATCATCATCTACATGG


    I tried Emboss (cons, consambig, megamerger) but the problems are ambiguous nucleotides. I wrote a simple unix script and it worked just fine but not with large sequences (100MB). Any ideas that would work for larger files?

    Thanks for considering my question!

  • #2
    Maybe try and right a Perl file, I think that would be your best option for this.
    I personally don't know a tool for this.

    Comment


    • #3
      m1:a=fgetc(file1);
      b=fgetc(file2);
      if(a=='N')a=b;
      fputc(a,file3);
      if(feof(file1)==0)goto m1;

      Comment


      • #4
        thanks gsgs

        for your helpful reply. unfortunately I am not familiar with fgetc. I am on a Linux RedHat system.

        Comment


        • #5
          it's a pity with all those different systems ...
          do you have a C-compiler ? The simpler the better

          Comment


          • #6
            the system was not my choice

            I do have a c compiler an it is :
            gcc version 4.4.6 20120305 (Red Hat 4.4.6-4)

            does this help in anyway?

            Comment


            • #7
              yes, that could work in theory ...

              have you ever successfully compiled a simple C-program ?

              I'll test it (on Windows) and post it here later (or PM or email if you prefer)

              are the 2 files in fasta-format ?

              Comment


              • #8
                I guess I would be able to handle compiling a simple C program using:
                gcc infile.c -o outfile

                I have one file with two sequences but I can easily split into two.

                I could also try to compile the lines you send me myself if you could help me with the C formating:

                /* File: merger.c
                Function: Simple program to merge a reference sequence and with another sequence.
                */

                #include <stdio.h>

                void main ()
                {
                m1:a=fgetc(file1);
                b=fgetc(file2);
                if(a=='N')a=b;
                fputc(a,file3);
                if(feof(file1)==0)goto m1;
                }

                ???

                Thanks again for your help!

                Comment


                • #9
                  /* I'm not sure about Linux, (ascii 10 for end of line rather than
                  ascii 13 and ascii 10 for windows
                  it prints the result, redirect to a file via ">" - piping :
                  loba oldfile.fa ref.fa > newfile.fa

                  fasta-file with one sequence only, same length and lines and aligned to the reference
                  should it also handle multi-sequence-fasta-files ?

                  */


                  #include <stdio.h>
                  int a,b;
                  FILE *file1,*file2;

                  int main(int argc,char*argv[]){
                  if(argc<3){printf("\nusage:loba file1 file2\n\n");
                  printf("replaces N in file1 by what file2 has at that position\n");
                  exit(1);}


                  if((file1=fopen(argv[1],"rb"))==NULL){printf("\ncan't open file %s\n",argv[1]);exit(1);}
                  if((file2=fopen(argv[2],"rb"))==NULL){printf("\ncan't open file %s\n",argv[2]);exit(1);}

                  a=0;while(a!=10){a=fgetc(file1);printf("%c",a);} /* first line printed */
                  a=0;while(a!=10)a=fgetc(file2); /* first line ignored (fasta-format ?)*/

                  m1:;
                  a=fgetc(file1);
                  b=fgetc(file2);
                  if(a=='N')a=b;
                  printf("%c",a);
                  if(feof(file1)==0)goto m1;
                  fclose(file1);fclose(file2);

                  }
                  Last edited by gsgs; 12-17-2012, 05:14 AM.

                  Comment


                  • #10
                    it works - thanks !

                    the compiler finishes with warning but no errors (see below) - I guess that is ok?
                    I tested it and it works now I have to test it with a big file !!

                    Thank you very much for your help !

                    merger.c: In function ‘main’:
                    merger.c:21: warning: incompatible implicit declaration of built-in function ‘exit’
                    merger.c:23: warning: incompatible implicit declaration of built-in function ‘exit’
                    merger.c:24: warning: incompatible implicit declaration of built-in function ‘exit’

                    Comment


                    • #11
                      if it works, the warnings are no problem
                      maybe it should be exit() instead of exit(1) for your compiler

                      Comment

                      Latest Articles

                      Collapse

                      • seqadmin
                        Best Practices for Single-Cell Sequencing Analysis
                        by seqadmin



                        While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                        06-06-2024, 07:15 AM
                      • seqadmin
                        Latest Developments in Precision Medicine
                        by seqadmin



                        Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                        Somatic Genomics
                        “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                        05-24-2024, 01:16 PM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by seqadmin, 06-07-2024, 06:58 AM
                      0 responses
                      179 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 06-06-2024, 08:18 AM
                      0 responses
                      228 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 06-06-2024, 08:04 AM
                      0 responses
                      184 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 06-03-2024, 06:55 AM
                      0 responses
                      18 views
                      0 likes
                      Last Post seqadmin  
                      Working...
                      X