Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bowtie2 stops during alignment

    Hi everybody,

    I am aligning Illumina 100bp reads to a reference transcriptome using bowtie2. When aligning certain fastq files, bowtie stops aligning always at the same position. The first read, below is the last that bowtie aligns. Afterwards bowtie stops. I ran fastqc on the files anyway and it reported no errors. Bases and Quality strings seem to have the same length so I cannot find a reason for the alignment stop. Does anybody had the same sort of errors when using bowtie2 ?

    Thanks in advance,

    Moritz

    @HWI-ST748:1811K3YACXX:6:1101:20680:72912 1:N:0:ACTTGA
    GTGCAACAGTACCAGCAACAAATGAAGGTAAAACACCTCGATTTCTGTGCATTCAATGTTCCTCGACTTCTGTGCAGCAATCTCTCTTCTGGAAAATCGT
    +
    @@CFDFFFHFFDDFFEBFDH?ECHGIIJAEDHICGG1?FHBGIIDHIGEEAFIGH>BBBDGEGIJJ/@EDEHHHHHEC?@C:6@C;6;>@CCCD@C>:7?
    @HWI-ST748:1811K3YACXX:6:1101:20630:72949 1:N:0:ACTTGA
    GTTGTAACTGACCGGATCGCAGGCAGATTGCCCCAGCTTTAAATTAGTCATTGTTGGCGATGGAGGCACTGGGAAGACGACTTTTGTCAAACGCCATCTT
    +
    CCCFFFFFHHHHHJJJJIJJJJJJJJIJFJEHJJJJJJJJIIIGHHIGGIJJJJJIJIHHFFFEEDBBDDCDD?C?BDDDDDDDDDDDEEDDDDDDDDCC
    @HWI-ST748:1811K3YACXX:6:1101:20750:72956 1:N:0:ACTTGA
    ATGAACTTCAAGCTCTGACTGAGAAAGCCGTTATTCACGATTGGAAGGAGACCGAGTCTTGGAGGCTGTTGAAGCAGCTCACTAAATCAGTTCAACATCG

  • #2
    Does the program print any error message? or it just stoped.

    Comment


    • #3
      Hi Luyi Tian,
      thanks for your fast response!
      The program itself is quiet but I piped the bowtie output to samtools view to generate bam files and samtools reports: "Parse error at line 1299638: sequence and quality are inconsistent."

      Moritz

      Comment


      • #4
        Problem solved by upgrading to Version 2.0.5.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Essential Discoveries and Tools in Epitranscriptomics
          by seqadmin




          The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
          Yesterday, 07:01 AM
        • seqadmin
          Current Approaches to Protein Sequencing
          by seqadmin


          Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
          04-04-2024, 04:25 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 04-11-2024, 12:08 PM
        0 responses
        57 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 10:19 PM
        0 responses
        53 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 09:21 AM
        0 responses
        45 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-04-2024, 09:00 AM
        0 responses
        55 views
        0 likes
        Last Post seqadmin  
        Working...
        X