Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • repinementer
    Member
    • Dec 2009
    • 80

    #16
    Hi guys does any one know how to convert this format to SAM ?
    Author of this paper mentioned this is SAM format but it is not working with Cufflinks.
    And it is not looking like the SAM format mentioned in SAM website.
    Any help would be appreciated!

    head 3125_8.sam
    IL6_3125:8:58:1625:1479 67 clone::AL662826.11:1:145431:1 1261 0 37M * 0 247 AAAAGGAGTAGGCAGGAAAACAGTCAATTATGGATTC ?BBCBBBB@<BBBBCB@A@?B?B>@A@B@BABB?B@? MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
    IL6_3125:8:37:57:1851 131 clone::AL662826.11:1:145431:1 1458 0 37M * 0 262 GTGAATTGGAGTCCTGNGTTTTATTTTCCTTTCCCAC AB?@BBBAB<@?AAB:!<<BBB@BBBB@;BBBB=ABA MF:i:18 Aq:i:0 NM:i:1 UQ:i:0 H0:i:0 H1:i:4
    IL6_3125:8:58:1625:1479 147 clone::AL662826.11:1:145431:1 1471 0 37M * 0 -247 CTGAGTTTTATTTTCCTTTCCCACCTCAAACCCCACA @8???@<?:>@;<6@B:96BBB6BB>BAB;BBBB>BB MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
    IL6_3125:8:37:57:1851 83 clone::AL662826.11:1:145431:1 1683 0 37M * 0 -262 GAAGGACTTACTGAGATGGCTGCTCCCACTCTCCAGC BBACA?=BB=;BCABB9BC7AC9BAAA>AB5@/?CC@ MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
    IL6_3125:8:93:491:1573 67 clone::AL662826.11:1:145431:1 3983 0 37M * 0 221 CTGGAATACAGAGGTTTTCACGGAAGCCCAGGGGACC BCB?BBCCBBBBBBABCCBBC>>AB>ABA@;9>8>=B MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0
    IL6_3125:8:93:491:1573 147 clone::AL662826.11:1:145431:1 4167 0 37M * 0 -221 CTCCCCCAGCCCAGGGGTCTGGCTTCCCCAGGAGGAC =;?>A?A>=9A@A?<5>?=@@AA?ABAAAA@BA@AAA MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:1
    IL6_3125:8:81:1190:1139 131 clone::AL662826.11:1:145431:1 6556 0 37M * 0 238 CACAGTAGAGCTTGGAGCAGAGATGCTAGGCCCCTAT BCBBBBC@BCBCCBC@BCBCBB;ABBB@BBBBABBB@ MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
    IL6_3125:8:81:1190:1139 83 clone::AL662826.11:1:145431:1 6757 0 37M * 0 -238 CCCAGAAGGAGCCAGGGCAGCACTTGGCAAGCTGCCC A99@AAAABBBABBABBAABBBB<BBA=BBABAB@@B MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
    IL6_3125:8:90:135:1121 131 clone::AL662826.11:1:145431:1 8359 0 37M * 0 155 CCTGTGTGTGCACATGTGCACGTGTATGTGTATGTGT B>AAACBC>BBCBAA<7A=B55):?B@CBC26@B9=9 MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
    IL6_3125:8:90:135:1121 83 clone::AL662826.11:1:145431:1 8477 0 37M * 0 -155 ACTGACGTCTGCTGAAATCAAGCATGGCCCCTGCTGG ;=>>?BA>@@@>>@A>BBAAAAAAABCBA?@@BCCCB MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      New Genomics Technologies Take Aim at Long-Standing Limits
      by SEQadmin2


      Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

      We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
      ...
      Yesterday, 10:25 AM
    • SEQadmin2
      How Immunogenomics Decodes Immunity’s Genetic Blueprint
      by SEQadmin2




      The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

      This convergence of genetics, immunology, and computation...
      09-01-2026, 05:41 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Today, 09:51 AM
    0 responses
    10 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 09-25-2026, 09:06 AM
    0 responses
    32 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 09-23-2026, 11:05 AM
    0 responses
    27 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 09-18-2026, 11:37 AM
    1 response
    48 views
    0 reactions
    Last Post pekgio
    by pekgio
     
    Working...