Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • wjeck
    Member
    • Mar 2009
    • 39

    Notes from trying BreakDancer

    I am trying BreakDancer for the first time in my lab and I thought I'd make a little post.

    First off, these files have significant dependencies. Make sure you know how to work with cpan packages to get them installed before you embark into working with BreakDancer. I am working in Ubuntu so my notes on this process are likely to be less useful to most people, but just a heads up.

    Secondly, you'll also want samtools installed, and preferably include its location in your path, if you plan to work with bam files. Anyone using BreakDancer with the bam file format (which I am, exclusively) will want to run bam2cfg.pl on their sample. I found that bam2cfg.pl has a hardcoded path to samtools, which is silly. You should edit lines 51 and 160 of this script to have your path to samtools.

    Thirdly, all output is directed to std out. I don't think it mentions this in the readme. It'll save you a wasted run.

    Also, it runs very quickly! I ran it on 14905688 PE Illumina reads and had results in less than 20 min on my Intel Core2 Quad CPU 2.66 GHz workstation.

    I do want to mention that there is some bug (possibly my fault) where BreakDancerMini gives me the following error message:

    Use of uninitialized value in subtraction (-) at BreakDancerMini.pl line 298, <$fh> line 433555
    repeatedly, though it still seems to work. Let me know, anyone, if you know what's up with that.

    --Will
  • ramouz87
    Member
    • Oct 2009
    • 35

    #2
    bam2cgf.pl

    Hi,
    I'm willing to use Breakdancer but when i try to generate the cfg file using bam2cgf.pl script
    # create cfg file for breakdancer
    bam2cfg.pl ./bam/pr_5000_rf_2_50b_X.bowtie.bam > ./sv/pr_5000_rf_2_50b_X.bowtie.bam.lst
    i get an empty file but no error message is displayed
    I've already corrected the path to Samtools
    Any idea about the reason that could lead to this ?
    Thanks in advance,
    Regards,
    Ramzi
    Research Scientist - Bioinformatics
    Sidra Medical and Research Center

    Comment

    • wjeck
      Member
      • Mar 2009
      • 39

      #3
      The only thing I can think of is that your data is coming out of bowtie whereas mine came from BWA. It's possible that there are some tags or header info that BWA adds that Bowtie is not. That's the only thing I can come up with, though. For trying to be an industry standard, bam formats still have a little bit of a ways to go.

      Comment

      • ramouz87
        Member
        • Oct 2009
        • 35

        #4
        empty file with bam2cfg.pl with both Bowtie/BWA

        Hi,
        Thanks for you reply, I've tried with BWA but still have an empty file when appliying bam2cfg.pl
        bwa sampe -a 5000 ~/genomes/Homo_sapiens.GRCh37.56.dna.toplevel.fa ./sai/s_8_1_sequence.fq.bwa.align.sai ./sai/s_8_2_sequence_50b.fq.bwa.align.sai ./fastq/s_8_1_sequence.fq ./fastq/s_8_2_sequence_50b.fq > ./sam/pr_5000_2_50b.bwa.sam

        bam2cfg.pl ./bam/pr_5000_2_50b.bwa.bam > ./sv/pr_5000_2_50b.bwa.bam.lst

        Beside, I get no error message.

        Any intuition regarding the origin of this issue.
        Thanks in advance
        Best,
        Ramzi
        Research Scientist - Bioinformatics
        Sidra Medical and Research Center

        Comment

        • wjeck
          Member
          • Mar 2009
          • 39

          #5
          Try sorting the bam file. Other than that I think I am out of ideas. I had no difficulties besides the ones mentioned, and those all generated errors before I fixed them.

          sort bams with

          samtools sort whatever.bam whatever.s

          and it will pop out a file called whatever.s.bam

          Good luck!

          Comment

          • ramouz87
            Member
            • Oct 2009
            • 35

            #6
            Hi,
            Tried sorting the bam but seems it's not the source of the problem.
            do you have @SQ header in the bam file you are using ?
            ####line num: proceeded byt weh line number are part i've added my self to trak the process
            i dont get wy the script takes the 13 first SQ header out ouf 93 and then print 3 lines and stop.
            here's the output i get:
            @SQ SN:gi|224589800|ref|NC_000001.10| LN:249250621
            ####line num:1@SQ SN:gi|224589815|ref|NC_000003.11| LN:198022430
            ####line num:2@SQ SN:gi|224589817|ref|NC_000005.9| LN:180915260
            ####line num:3@SQ SN:gi|224589819|ref|NC_000007.13| LN:159138663
            ####line num:4@SQ SN:gi|224589821|ref|NC_000009.11| LN:141213431
            ####line num:5@SQ SN:gi|224589802|ref|NC_000011.9| LN:135006516
            ####line num:6@SQ SN:gi|224589804|ref|NC_000013.10| LN:115169878
            ####line num:7@SQ SN:gi|224589806|ref|NC_000015.9| LN:102531392
            ####line num:8@SQ SN:gi|224589808|ref|NC_000017.10| LN:81195210
            ####line num:9@SQ SN:gi|224589810|ref|NC_000019.9| LN:59128983
            ####line num:10@SQ SN:gi|224589813|ref|NC_000021.8| LN:48129895
            ####line num:11@SQ SN:gi|224589822|ref|NC_000023.10| LN:155270560
            ####line num:12@SQ SN:gi|17981852|ref|NC_001807.4| LN:16571
            ####line num:13HWI-EA332_8_85_1430_1875#AGGGNN/1 83 gi|224589800|ref|NC_000001.10| 10001 255 75M = 11883 1932 GAACTCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA %%%%%%%%%%%%%%%%4348-(17675475=86:6=6=688:5B8B2B6==ABCAB?CBA<CBCCBAB@B<CCCB XA:i:2 MD:Z:0T3C70 NM:i:2
            ####line num:14HWI-EA332_8_26_1634_348#TGGGNN/1 83 gi|224589800|ref|NC_000001.10| 10003 255 75M = 10260 307 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC %%%%%%%%%%%%%%%5..33<1//2:;@??6<<@4@8?>AA@6@AA8B8?BBBB<ABB@B=BB@;B;BBCBC?CB XA:i:0 MD:Z:75 NM:i:0
            ####line num:15NANA????HWI-EA332_8_63_322_1051#GGAGNN/1 83 gi|224589800|ref|NC_000001.10| 10004 255 75M = 10399 445 CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAACC %%%%%9959=<3:B>9?>B-B>3@BB@:>:@@=9A:@B@=@;B;@CCAAA@@C@@AB??BCCC>C9BBBCCCBCB XA:i:0 MD:Z:72C2 NM:i:1

            it's strange but there's for sure a reason bihind that.
            thanks again for the help
            Research Scientist - Bioinformatics
            Sidra Medical and Research Center

            Comment

            • wjeck
              Member
              • Mar 2009
              • 39

              #7
              That is really odd. This release certainly seems to be less that user friendly. My files have no header info, which might be why breakdancer-mini failed for me, but why breakdancer max worked.

              Good luck sorting it out

              Comment

              • ramouz87
                Member
                • Oct 2009
                • 35

                #8
                Hi,
                I guess the problem arise from the header format, would you mind sending me the head of your bam file so i compare with the one i have.
                here's the header of my file :

                here's the header of the bam file from bwa:
                @SQ SN:GL000207.1 LN:4262
                @SQ SN:GL000226.1 LN:15008
                @SQ SN:GL000229.1 LN:19913
                @SQ SN:GL000231.1 LN:27386
                @SQ SN:GL000210.1 LN:27682
                @SQ SN:GL000239.1 LN:33824
                @SQ SN:GL000235.1 LN:34474
                @SQ SN:GL000201.1 LN:36148
                @SQ SN:GL000247.1 LN:36422
                @SQ SN:GL000245.1 LN:36651
                @SQ SN:GL000197.1 LN:37175
                @SQ SN:GL000203.1 LN:37498
                @SQ SN:GL000246.1 LN:38154
                @SQ SN:GL000249.1 LN:38502
                @SQ SN:GL000196.1 LN:38914
                @SQ SN:GL000248.1 LN:39786
                @SQ SN:GL000244.1 LN:39929
                @SQ SN:GL000238.1 LN:39939
                @SQ SN:GL000202.1 LN:40103
                @SQ SN:GL000234.1 LN:40531
                @SQ SN:GL000232.1 LN:40652
                @SQ SN:GL000206.1 LN:41001
                @SQ SN:GL000240.1 LN:41933
                @SQ SN:GL000236.1 LN:41934
                @SQ SN:GL000241.1 LN:42152
                @SQ SN:GL000243.1 LN:43341
                @SQ SN:GL000242.1 LN:43523
                @SQ SN:GL000230.1 LN:43691
                @SQ SN:GL000237.1 LN:45867
                @SQ SN:GL000233.1 LN:45941
                @SQ SN:GL000204.1 LN:81310
                @SQ SN:GL000198.1 LN:90085
                @SQ SN:GL000208.1 LN:92689
                @SQ SN:GL000191.1 LN:106433
                @SQ SN:GL000227.1 LN:128374
                @SQ SN:GL000228.1 LN:129120
                @SQ SN:GL000214.1 LN:137718
                @SQ SN:GL000221.1 LN:155397
                @SQ SN:GL000209.1 LN:159169
                @SQ SN:GL000218.1 LN:161147
                @SQ SN:GL000220.1 LN:161802
                @SQ SN:GL000213.1 LN:164239
                @SQ SN:GL000211.1 LN:166566
                @SQ SN:GL000199.1 LN:169874
                @SQ SN:GL000217.1 LN:172149
                @SQ SN:GL000216.1 LN:172294
                @SQ SN:GL000215.1 LN:172545
                @SQ SN:GL000205.1 LN:174588
                @SQ SN:GL000219.1 LN:179198
                @SQ SN:GL000224.1 LN:179693
                @SQ SN:GL000223.1 LN:180455
                @SQ SN:GL000195.1 LN:182896
                @SQ SN:GL000212.1 LN:186858
                @SQ SN:GL000222.1 LN:186861
                @SQ SN:GL000200.1 LN:187035
                @SQ SN:GL000193.1 LN:189789
                @SQ SN:GL000194.1 LN:191469
                @SQ SN:GL000225.1 LN:211173
                @SQ SN:GL000192.1 LN:547496
                @SQ SN:21 LN:48129895
                @SQ SN:22 LN:51304566
                @SQ SN:19 LN:59128983
                @SQ SN:Y LN:59373566
                @SQ SN:Y LN:59373566
                @SQ SN:20 LN:63025520
                @SQ SN:18 LN:78077248
                @SQ SN:17 LN:81195210
                @SQ SN:HSCHR17_1 LN:81347271
                @SQ SN:16 LN:90354753
                @SQ SN:15 LN:102531392
                @SQ SN:14 LN:107349540
                @SQ SN:13 LN:115169878
                @SQ SN:12 LN:133851895
                @SQ SN:11 LN:135006516
                @SQ SN:10 LN:135534747
                @SQ SN:9 LN:141213431
                @SQ SN:8 LN:146364022
                @SQ SN:X LN:155270560
                @SQ SN:7 LN:159138663
                @SQ SN:HSCHR6_MHC_COX LN:171036692
                @SQ SN:HSCHR6_MHC_QBL LN:171043904
                @SQ SN:HSCHR6_MHC_DBB LN:171092990
                @SQ SN:HSCHR6_MHC_APD LN:171098467
                @SQ SN:6 LN:171115067
                @SQ SN:HSCHR6_MHC_SSTO LN:171254423
                @SQ SN:HSCHR6_MHC_MANN LN:171268957
                @SQ SN:HSCHR6_MHC_MCF LN:171285427
                @SQ SN:5 LN:180915260
                @SQ SN:HSCHR4_1 LN:191036604
                @SQ SN:HSCHR4_1 LN:191036604
                @SQ SN:4 LN:191154276
                @SQ SN:3 LN:198022430
                @SQ SN:2 LN:243199373
                @SQ SN:1 LN:249250621
                HWI-EA332_8_1_3_1738#CCCCNN 117 17 18859426 0 * = 18859426 0 GGGATGAGGACAGGGACCCCACCCTTCAGTGGGAGGAGTGTCAATATTAGACTGTAGGAAGAGCAGGCGGGCTAN %%%%%%%%%%%%%%%%%%%%%%%0.2,266646543668668866
                HWI-EA332_8_1_3_1738#CCCCNN 153 17 18859426 0 50M = 18859426 0 GAACGCGGGAGGCAGAGGTTGCGGTGAGCCAAGATCATGCCATTGCACTC %%%%%%B,?<4+,991>+;<?5.205&4B9@=;A@B=B@BBBABBB@B@B XT:A:R NM:i:
                HWI-EA332_8_1_3_659#GGGGNN 77 * 0 0 * * 0 0 NTCTCCCTCCTTGATCCAGCATTATCAGCATCTGGCCCCACACATACTCTCCATGTTCTTGACCCAGCATGTTGG &/898778788988889886688896887898858888655798864636%%%%%%%%%%%
                HWI-EA332_8_1_3_659#GGGGNN 141 * 0 0 * * 0 0 GCTGTGTTAGGAAGAAATGTCTCAAACAACAACAAAAAGCCCTCAAGAGA BB9@4?=B>:::2<=C@6>/94>4*@=?%%%%%%%%%%%%%%%%%%%%%%
                HWI-EA332_8_1_3_1261#AGGGNN 77 * 0 0 * * 0 0 NAAAATCATGCCATCCTTGATTTTTCTGATTTCTTTTATTGTTTCTATTTTAAACATTCTATTTAGCTGACAGAC &0:9:;6::<<<;69;;71.,<<<:4.&*.*;::/7555:::<:9869999:%%%%%%%%%
                HWI-EA332_8_1_3_1261#AGGGNN 141 * 0 0 * * 0 0 CAGTGCCCAGGACAGAGGAAGCACCCTGTGAATGGTCGCCCCTGCTGGTA B@=*9AAAB>79809719>==699%%%%%%%%%%%%%%%%%%%%%%%%%%
                HWI-EA332_8_1_3_1094#AGGANN 77 * 0 0 * * 0 0 NAGAACTACTTCAAAACATAGAGTAAAAGTGTAAAGACATGAAAACTATGAAGAACAAGACTAGAAGATAAACCC &19:;;<<<<<<<<<<<<<999:97868<8:997998::9:999::9<9:242789/'069
                HWI-EA332_8_1_3_1094#AGGANN 141 * 0 0 * * 0 0 CTTCTCAGACAAGGGAACCACCCCCCCAGGTACCACATTCCACGGCTGCC BBBAA>/76>;:54%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
                HWI-EA332_8_1_3_1942#TTTTNN 77 * 0 0 * * 0 0 NCACAAATTTGAAGGCTATCCTTTAGGTAATGACTGTAAATAGAGATAATAAAAGGTATATAATTTATATAAACT &1668:::<70365588555647402..454%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
                HWI-EA332_8_1_3_1942#TTTTNN 141 * 0 0 * * 0 0 CATAGTGATCTCACGCTGGTATGAGGAAAGAGGTAACACCGAAAAAATGC A;A=@A>9BCBB?BABA@A=<@>4@88;=A=@A?>A@>9*>@88=;=86%
                HWI-EA332_8_1_3_1768#GCAANN 77 * 0 0 * * 0 0 NAGTATACAGGGAAATTAGTTTCCAAATTGCTAATGCTTATTATCTCTTTGATAAATAAATTTATCAACTATAGT &.<;;8<:87667<<:<;;;:<7727:<;:6;<<;<:;<<<<<<:<<9;:::<7966699<
                HWI-EA332_8_1_3_1768#GCAANN 141 * 0 0 * * 0 0 GAGGCAGCAGAGTCACTTGAACCCGGGAGGCAGAGGCTGCAGTCAGTGGA A@>AAAAB@@A@?A=A?A?7@A@B=:=9=B>+A/7<'>:;9=9===6?/6
                HWI-EA332_8_1_3_1920#AAAANN 77 * 0 0 * * 0 0 NTGTGGACCGCAGGCACTGTCTGCATTCCCTACCTACCCACCCCACTTCCCGTGTTCTAACTTGGTTCTGGTGCT &/6666%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
                HWI-EA332_8_1_3_1920#AAAANN 141 * 0 0 * * 0 0 AATACTTTTTAGAAATAATTTTGAGAGCTCCAAGGAGAATGAAAAGCAAA BBA6ACCBCC@B;:4B@+@CCCC<AACBBBC@9?B:A4<BA8*19A8@89
                HWI-EA332_8_1_3_558#TTTCNN 77 * 0 0 * * 0 0 NGAAATGGATTTTTAAGCAGAATTTAAAGAAAGTATTCCAACTTAGATTTTTCTGGGTTAGAAAATAAAAATATT &0:7:<;<1;;;<<4715;9<<:<;<8;87<;:7:3:4<1(+9:03%%%%%%%%%%%%%%%
                HWI-EA332_8_1_3_558#TTTCNN 141 * 0 0 * * 0 0 TAAATGAGTGTGCTGAAATCATGGACTTCTTTATCATCATAACAGACAAG AB=@=B?>@B:@BA73?B=BB2@BB@>BB<?B?+C?5966:=;<%%%%%%

                here's the parameter for samtools view : samtools view -Sbhut ~/genomes/Homo_sapiens.GRCh37.56.dna.toplevel.fa

                could it be the reference genome Homo_sapiens.GRCh37.56.dna.toplevel.fa ?

                Thanks in advance.
                Regards,
                Ramzi
                Research Scientist - Bioinformatics
                Sidra Medical and Research Center

                Comment

                • wjeck
                  Member
                  • Mar 2009
                  • 39

                  #9
                  I modded my hg18 reference a little, but my header looks like this:

                  @SQ SN:chrM LN:16571
                  @SQ SN:chr1 LN:247249719
                  @SQ SN:chr2 LN:242951149
                  @SQ SN:chr3 LN:199501827
                  @SQ SN:chr4 LN:191273063
                  @SQ SN:chr5 LN:180857866
                  @SQ SN:chr6 LN:170899992
                  @SQ SN:chr7 LN:158821424
                  @SQ SN:chr8 LN:146274826
                  @SQ SN:chr9 LN:140273252
                  @SQ SN:chr10 LN:135374737
                  @SQ SN:chr11 LN:134452384
                  @SQ SN:chr12 LN:132349534
                  @SQ SN:chr13 LN:114142980
                  @SQ SN:chr14 LN:106368585
                  @SQ SN:chr15 LN:100338915
                  @SQ SN:chr16 LN:88827254
                  @SQ SN:chr17 LN:78774742
                  @SQ SN:chr18 LN:76117153
                  @SQ SN:chr19 LN:63811651
                  @SQ SN:chr20 LN:62435964
                  @SQ SN:chr21 LN:46944323
                  @SQ SN:chr22 LN:49691432
                  @SQ SN:chrX LN:154913754
                  @SQ SN:chrY LN:57772954

                  Not sure what's going on here, since your header looks kosher.

                  Comment

                  • pallo
                    Member
                    • Oct 2009
                    • 10

                    #10
                    Just started playing with BreakDancer and ran into the same problem with bam2cfg.pl, that is, it returned nothing, when run on a single lane bam of my solexa results.

                    I think I have found the problem (and a solution). bam2cfg.pl expects at least one library name from either the header of the bam file ("@RG..." lines) or from a config file specified with the -f switch. When neither of these are supplied, the script simply assigns every result in the bam file to the library "NA". The problem is that before it starts assigning all the alignments to lib "NA", it counts the number of libraries specified and calculates the number of expected results needed to calculate the statistics it returns with the formula:

                    $expected_max=3*($#libas+1)*$opts{n}

                    where $#libas is the number of specified libs and $opts{n} is preset at 10000. As I had 0 specified libs, the number of expected records needed to calculate the stats was set at zero and therefore the script never gets around to actually scan the records, but simply exits with nothing to report.

                    The solution to the problem in my case is to reset the count of libraries, after the "default" library "NA" has been added, in which case the formula above yields 30000. The library count can be set in several ways, but in my case I did it by re-arranging this code block (line 69...):

                    Code:
                    my @libas=keys %libs;
                    if(!defined $expected_max){
                      $expected_max=3*($#libas+1)*$opts{n};
                    }
                    my @selected_libs=keys %insert_stat;
                    if($#libas<0){
                      if($#selected_libs>=0){
                        last;
                      }
                      else{
                        $libs{'NA'}=1;
                        $RGlib{'NA'}='NA';
                      }
                    }
                    to this:

                    Code:
                    my @libas=keys %libs;
                    my @selected_libs=keys %insert_stat;
                    if($#libas<0){
                      if($#selected_libs>=0){
                        last;
                      }
                      else{
                        $libs{'NA'}=1;
                        $RGlib{'NA'}='NA';
                      }
                    }
                    @libas=keys %libs;
                    if(!defined $expected_max){
                      $expected_max=3*($#libas+1)*$opts{n};
                    }
                    HTH.

                    Comment

                    • townway
                      Member
                      • May 2009
                      • 41

                      #11
                      I got this when i ran bam2cfg.pl, do you know how to fix it?

                      Use of uninitialized value in multiplication (*) at bam2cfg.pl line 121.
                      Use of uninitialized value in division (/) at bam2cfg.pl line 128.

                      Comment

                      • pallo
                        Member
                        • Oct 2009
                        • 10

                        #12
                        Originally posted by townway View Post
                        I got this when i ran bam2cfg.pl, do you know how to fix it?

                        Use of uninitialized value in multiplication (*) at bam2cfg.pl line 121.
                        Use of uninitialized value in division (/) at bam2cfg.pl line 128.
                        I believe this is a manifestation of the "bug" I mentioned above. As the script never actually scans through the bam file, the stats it is supposed to produce never get produced, and therefore some values in the final calculations never get initialized.

                        Comment

                        • tata
                          Junior Member
                          • Dec 2009
                          • 2

                          #13
                          error while running BreakDancer's bam2cfg

                          I am getting this error when running bam2cfg on bam file with data from SOLID:

                          [samopen] inconsistent number of target sequences.

                          does anybody get the same error and what you think is the cause of it?

                          Comment

                          • fabio.marroni
                            Junior Member
                            • Jun 2009
                            • 6

                            #14
                            I am trying to run BreakDancer Max on a data set including only one library. Alignment with BWA created an alignment file in which no library name was specified (no @RG header). The bam2cfg.pl included in BreakDancer-0.0.1 (which seems to have incorporated the suggestion from pallo) ran and produced the following config file (config.file):

                            readgroup:NA platform:illumina map:../Poli/s_1_sequence.bam readlen:75.00 lib:NA num:10001 lower:130.99 upper:275.98 mean:210.78 std:18.14 exe:samtools view

                            We then ran BrakDancer Max with the following command

                            perl BreakDancerMax.pl config.file >output.file

                            and obtained the following (empty) output file
                            #../Poli/s_1_sequence.bam mean:210.780 std:18.140 uppercutoff:275.980 lowercutoff:130.990 readlen:75.000 library:NA reflen:484660925 seqcov:4.744x phycov:6.667x 1:1784 2:60640 3:59812 4:8280 8:2320 32:48156
                            #Chr1 Pos1 Orientation1 Chr2 Pos2 Orientation2 Type Size Score num_Reads num_Reads_lib Allele_frequency Version Run_Param

                            Can someone help with this issue?

                            Comment

                            • fabio.marroni
                              Junior Member
                              • Jun 2009
                              • 6

                              #15
                              Originally posted by wjeck View Post
                              I am trying BreakDancer for the first time in my lab and I thought I'd make a little post.

                              I do want to mention that there is some bug (possibly my fault) where BreakDancerMini gives me the following error message:

                              Use of uninitialized value in subtraction (-) at BreakDancerMini.pl line 298, <$fh> line 433555

                              repeatedly, though it still seems to work. Let me know, anyone, if you know what's up with that.

                              --Will
                              I get exactly the same message only in breakdancer mini. It's a warning, not an error, results looks fine, but I don't know if we can ignore the warning. I read the perlmonks link (http://www.perlmonks.org/?node_id=551296), but I have no idea if the warning is a problem or not.

                              Comment

                              Latest Articles

                              Collapse

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 06-09-2026, 11:58 AM
                              0 responses
                              24 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-05-2026, 10:09 AM
                              0 responses
                              29 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-04-2026, 08:59 AM
                              0 responses
                              39 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-02-2026, 12:03 PM
                              0 responses
                              61 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...