Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • zlu
    Member
    • Nov 2008
    • 34

    #1

    BWA sampe: wierd pairing

    When running bwa (0.5.4) smape I got this line output to the screen over and over again:

    [infer_isize] fail to infer insert size: weird pairing

    Should I be worrying about this? Does it mean the pairing is not correct?

    The following are the commands I used for alignment and sampe:

    bwa aln -l 32 -t 2 -q 4 Genomes/Btau_UMD3.fa s_1_1_sequence.fq > Run20_s_1_1_sequence.sai & bwa aln -l 32 -t 2 -q 4 Genomes/Btau_UMD3.fa s_1_2_sequence.fq > Run20_s_1_2_sequence.sai &

    bwa sampe -a 253 -o 1000 Genomes/Btau_UMD3/Btau_UMD3.fa s_1_1_sequence.sai s_1_2_sequence.sai s_1_1_sequence.fq s_1_2_sequence.fq > Run20_s_1_pe.bwa.sam

    Thank you.
  • lh3
    Senior Member
    • Feb 2008
    • 686

    #2
    Bwa fails to infer insert size and will use "-a" to set the maximum insert size in pairing. This may happen if too few reads are mapped or the insert size distribution is bimodal or something alike. You should check the distribution after mapping.

    Comment

    • zlu
      Member
      • Nov 2008
      • 34

      #3
      The insert size specified was obtained from ELAND alignment. Do you think increasing the -a will help? And is there a tag in the sam file that reports pairing with wrong insert size?

      Comment

      • lh3
        Senior Member
        • Feb 2008
        • 686

        #4
        You should draw the distribution.

        Comment

        • zlu
          Member
          • Nov 2008
          • 34

          #5
          Thanks for the quick reply.

          Looking closer at the output from the sampe below, am I right to assume that there are 1649 out of 262144 processed reads where the insert size cannot be inferred correctly?

          [bwa_read_seq] 0.0% bases are trimmed.
          [bwa_sai2sam_pe_core] convert to sequence coordinate...
          [infer_isize] fail to infer insert size: weird pairing
          [bwa_sai2sam_pe_core] time elapses: 160.55 sec
          [bwa_sai2sam_pe_core] change of coordinates in 1649 alignments.
          [bwa_sai2sam_pe_core] align unmapped mate...
          [bwa_sai2sam_pe_core] time elapses: 1.39 sec
          [bwa_sai2sam_pe_core] refine gapped alignments... 0.72 sec
          [bwa_sai2sam_pe_core] print alignments... 2.13 sec
          [bwa_sai2sam_pe_core] 262144 sequences have been processed.

          Comment

          • elalo
            Junior Member
            • Dec 2009
            • 4

            #6
            Did you ever solve this issue? I'm encountering the same error message...

            Comment

            • lh3
              Senior Member
              • Feb 2008
              • 686

              #7
              This message is usually caused by bad libraries. You should check the quality of your library in the first place. As I replied above, bwa still works if -a is about right, but to set a proper -a, again, you should plot the distribution of insert size. This is not a major problem with bwa but with your input data.

              Comment

              • zlu
                Member
                • Nov 2008
                • 34

                #8
                My problem was actually due to the uneven number of pair reads in the input fastq files. I was doing some quality filterings, mainly artefacts removal, on read1 and read2 separately and this resulted in the 2 files having different number of reads.

                Comment

                • lh3
                  Senior Member
                  • Feb 2008
                  • 686

                  #9
                  No. You must make sure the two files contain the same set of pairs with identical order in each file. Your input will fail all aligners to date, so far as I know.

                  Comment

                  • elalo
                    Junior Member
                    • Dec 2009
                    • 4

                    #10
                    Thank you both for your help! It was indeed an issue with my library...

                    Comment

                    • valeu
                      Member
                      • Sep 2008
                      • 69

                      #11
                      Dear Heng,

                      I aligned my mate-pair data with BWA (0.5.5) and observed a weird pairing of reads. I explain below:

                      when I run bwa sampe for one of pairs I get:
                      Code:
                      HWUSI-EAS454:1:2:0:108#0        113     chr2    96713303        0       50M     =       96439877        -273426 GATCAGTGGACTTTATGTTAATGAAAAAGGAAATCATCCAGGGTGCATCT      :B?BC?A-357;67C@C<CC<9B>BC<BB>B:<7>B=-BCBBBC@BB@B@      XT:A:R  NM:i:2    SM:i:0  AM:i:0  X0:i:3  X1:i:0  XM:i:2  XO:i:0  XG:i:0  MD:Z:7T23C18
                      HWUSI-EAS454:1:2:0:108#0        177     chr2    96439877        23      50M     =       96713303        273426  GAGTCTCTTTTGCTGAGTGTTGTCATATATGGAGGTGATGCATGGAACTG      ?A95/5?@B;?:@7BB9959?'79BAC>@B?;@>;B(B8:/'>;9C:BBB      XT:A:U  NM:i:2    SM:i:23 AM:i:0  X0:i:1  X1:i:2  XM:i:2  XO:i:0  XG:i:0  MD:Z:28C12C8
                      So here the distance between ends is 273426bp, though I (and BWA) know that "inferred external isize from 157719 pairs: 3054.215 +/- 185.122".

                      When I run BWA in simple end mode "bwa samse -n 30" for the same pair I get:
                      >HWUSI-EAS454:1:2:0:108#0 3 3
                      chr2 -96713303 2
                      chr2 -98220112 2
                      chr2 +96442725 2

                      on the left and

                      >HWUSI-EAS454:1:2:0:108#0 3 3
                      chr2 -96439877 2
                      chr2 +98222957 3
                      chr2 +96716152 3

                      on the right.

                      So my question is why BWA decides to pair ends in such a weird way when I could pair them as:
                      left: chr2 +96442725 2
                      right: chr2 -96439877 2
                      with ~2800bp of insert size?

                      And also, why in the output of "bwa samse -n 30" there is no information about quality of mapping? Why can't it be printed in SAM format as well?

                      Thank you in advance,
                      Valentina

                      Comment

                      • lh3
                        Senior Member
                        • Feb 2008
                        • 686

                        #12
                        Could you show the low and high boundaries from the bwa output? Something like:

                        [infer_isize] low and high boundaries: 330 and 670

                        EDIT: For a "proper read pair", you would expect to see the read with small coordinate mapped to the forward strand but in your example, it is the contrary. I guess you are aligning reads from Illumina long-insert library where the "proper pair" has RF orientation. Bwa does not support such read pairs. So far as I know, Maq is still the best tool for such alignment.
                        Last edited by lh3; 01-15-2010, 08:29 AM.

                        Comment

                        • valeu
                          Member
                          • Sep 2008
                          • 69

                          #13
                          Low and high boundaries are: 2284 and 3824.

                          You are right, these are Solexa mate-pair data which should be aligned as "RF" instead of "FR"..

                          I have too much data to use Maq on them... Or I should run Bowtie first and then use Maq to align what was not aligned. But it is really a pitty that I cannot use BWA for that.

                          Maybe you could add a parameter that would specify which type of mapping you expect? Like you can run Bowtie in "--rf" or "--fr" mode.

                          Thanks,
                          Valentina

                          Comment

                          • smehr12
                            Junior Member
                            • May 2011
                            • 4

                            #14
                            Hi elalo,
                            How did you find out it was an issue with your library. How can I take of this isize failure message?

                            Comment

                            • smehr12
                              Junior Member
                              • May 2011
                              • 4

                              #15
                              Originally posted by zlu View Post
                              When running bwa (0.5.4) smape I got this line output to the screen over and over again:

                              [infer_isize] fail to infer insert size: weird pairing

                              Should I be worrying about this? Does it mean the pairing is not correct?

                              The following are the commands I used for alignment and sampe:

                              bwa aln -l 32 -t 2 -q 4 Genomes/Btau_UMD3.fa s_1_1_sequence.fq > Run20_s_1_1_sequence.sai & bwa aln -l 32 -t 2 -q 4 Genomes/Btau_UMD3.fa s_1_2_sequence.fq > Run20_s_1_2_sequence.sai &

                              bwa sampe -a 253 -o 1000 Genomes/Btau_UMD3/Btau_UMD3.fa s_1_1_sequence.sai s_1_2_sequence.sai s_1_1_sequence.fq s_1_2_sequence.fq > Run20_s_1_pe.bwa.sam

                              Thank you.
                              Hi zlu,

                              Do you mind tell me how you got rid of the failure message from bwa? I keep getting the message?

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM
                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 10:13 AM
                              0 responses
                              13 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-31-2026, 02:55 AM
                              0 responses
                              27 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-24-2026, 12:17 PM
                              0 responses
                              20 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-23-2026, 11:41 AM
                              0 responses
                              19 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...