BowTie Output Format

[Arupsss]

I have to find matching of short reads of a .fq file onto human genome. I am using BowTie for that.

Here is one read of my input file:

@10_71499258_71499890_0_1_0_0_1:0:0_2:0:0_0/1
TATTAGATCGTGTGATTATATTTGACAGGTCTTAATTGACGCGCTGTTCAGCCCTTTGAGTTCGGTTGAGTTTTGGGTTGGAGAATTTTCTTCCACAAGG
+
2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222

And BowTie outputs:

10_71499258_71499890_0_1_0_0_1:0:0_2:0:0_0/1	+	10	50100
TATTAGATCGTGTGATTATATTTGACAGGTCTTAATTGACGCGCTGTTCAGCCCTTTGAGTTCGGTTGAGTTTTGGGTTGGAGAATTTTCTTCCACAAGG
2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222	1

And

10_71499258_71499890_0_1_0_0_1:0:0_2:0:0_0/1	+	18	4514	TATTAGATCGTGTGATTATATTTGACAGGTCTTAATTGACGCGCTGTTCAGCCCTTTGAGTTCGGTTGAGTTTTGGGTTGGAGAATTTTCTTCCACAAGG	2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222	1

Can anybody inform me: what does this output means ? I mean: specially + 10 50100 and 1.

[GenoMax]

http://bowtie-bio.sourceforge.net/ma...-bowtie-output

[Arupsss]

http://bowtie-bio.sourceforge.net/ma...-bowtie-output

Thanks.

But, can you help me:

I can't understand the meaning of: last column of the BowTie output.

In manual it describes as:

"A single descriptor has the format offset:reference-base>read-base. The offset is expressed as a 0-based offset from the high-quality (5') end of the read."

What does it mean ? And how to find that offset ?

[dpryan]

Thanks.

But, can you help me:

I can't understand the meaning of: last column of the BowTie output.

In manual it describes as:

"A single descriptor has the format offset:reference-base>read-base. The offset is expressed as a 0-based offset from the high-quality (5') end of the read."

What does it mean ? And how to find that offset ?

You actually want to read about column 7, rather than column 8 (at least in the example posted). BTW, you might want to use SAM format in the future, since that's now the standard (and people won't have to remember the old bowtie format).