[emmanouela]

Reads with very long "deletions"

Hello,

I used STAR to map our rna-seq single-end reads which are 50bp long (both with and without a gtf file). However, I get quite a few reads which supposedly have these huge deletions/gaps of hundreds of kb, which look like mapping issues.
Some time the "deletions" even span entire genes within them.

Two examples are:
HISEQ2000-02:509:C4C7EACXX:4:1306:5718:46438 0 chr10 94874729 255 44M196485N7M * 0 0 TAACGGAACTCCTACTAGATACATCAGGATGCAAACTATAAAAGGGTCAGT @@@DDD?D@DDHB>?B<B<<CAC?BEDG?9*)1CF;<??BF*??B)?90?? NH:i:1 HI:i:1 AS:i:45 nM:i:1 jM:B:c,1 jI:B:i,94874773,95071257

HISEQ2000-02:509:C4C7EACXX:4:2303:5831:46194 0 chr10 95008269 255 23M125529N28M * 0 0 CAATAAAAACGTATACCGATTGGCAAAAAAAAAGAAAAAAAAAAAAAAAAA CBCFFFFFHHFHHJJJJHIIJHEHJJJJJJJJJ-5@GIJHFDDDDDDDDDD NH:i:1 HI:i:1 AS:i:39 nM:i:0 jM:B:c,5 jI:B:i,95008292,95133820


Has anyone else seen these? Is there any way to filter them out???

[GenoMax]

Pre-compiled linux binary is available here: https://code.google.com/p/rna-star/d...4.tgz&can=2&q=

[kjusto]

Hi guys,
1.Any package available for STAR for easy installing
2. Architecture: i686 CPU op-mode(s): 32-bit, 64-bit CPU(s): 2 is it compatible with any of STAR app either from binary or source
Thanks

[alexdobin]

Alex, is it possible to integrate your instrument to the Tool Panel of Main Public Galaxy Server (usegalaxy.org) as a working tool?

This is certainly doable, however, such decisions are in the hands of the Galaxy Team - please make a request of Anton Nekrutenko & Co.

Cheers
Alex

[dxkorall]

Alex, is it possible to integrate your instrument to the Tool Panel of Main Public Galaxy Server (usegalaxy.org) as a working tool?

[apredeus]

yeah file Log.out has actual mapping speed

so check it to see, it's usually somewhere around hundreds of millions (reads) per hour on 8 CPUs

if it's substantially lower, something is going wrong (i.e. if you use UCSC mRNAs as a reference there is a lot of junctions that are of "-1" length for whatever reason, so it slows STAR down a lot)

[sindrle]

Holy moly.

[dpryan]

That sounds about right. STAR is vastly faster than tophat, but requires much more memory.

[sindrle]

Quick question, on a fastq file Tophat2 spends about 3-4h, STAR runs in 5 min - 1.5h.

How come only 5 min? Thats almost unbelievable.. It says success, but Im very sceptical..

[alexdobin]

Thanks. It works. I have another problem, when indexing the genome, does STAR accept gzipped fasta file? It didn't work for me and got "BUG: next index is smaller than previous", I also tried --readFilesCommand zcat, still didn't work. But when I unzip the fasta file, it works.

Hi Shangzhong,

for genome generation, STAR needs unzipped fasta. You do it once per genome, and can delete the fasta after the genome is generated. '--readFilesCommand zcat' option only applies to fastq/fasta reads at the mapping stage.

Cheers
Alex

[shangzhong0619]

Hi Shangzong,

please try this patch http://labshare.cshl.edu/shares/ging...R_2.3.1z10.tgz

If this does not help, please use the pre-compiled STAR or STARstatic executables in the source directory.

Cheers
Alex

Thanks. It works. I have another problem, when indexing the genome, does STAR accept gzipped fasta file? It didn't work for me and got "BUG: next index is smaller than previous", I also tried --readFilesCommand zcat, still didn't work. But when I unzip the fasta file, it works.

[alexdobin]

Hi Shangzong,

please try this patch http://labshare.cshl.edu/shares/ging...R_2.3.1z10.tgz

If this does not help, please use the pre-compiled STAR or STARstatic executables in the source directory.

Cheers
Alex

[shangzhong0619]

Hi Shangzhong,

please try one of the latest STAR patches.
Do you have a large number of contigs/scaffolds in your genome assembly? This would explain the error message (see this post). If so, you need to use --genomeChrBinNbits 14 or smaller.

You can find brief description of all parameters at the end of the manual, or in the parametersDefault file in the source directory. If you want to use annotations to improve mapping accuracy, you will need:

sjdbGTFfile -
string: path to the GTF file with annotations

sjdbOverhang 0
int>=0: length of the donor/acceptor sequence on each side of the junctions, ideally = (mate_length - 1)
if =0, splice junction database is not used

Cheers
Alex

Hi Alex,
Thanks for your reply, yes my reference fasta has many scaffolds. When I try to install the latest version, it shows the following effor.


samtools/libbam.a(bgzf.o): In function `bgzf_compress':
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:187: undefined reference to `deflateInit2_'
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:188: undefined reference to `deflate'
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:189: undefined reference to `deflateEnd'
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:195: undefined reference to `crc32'
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:195: undefined reference to `crc32'
samtools/libbam.a(bgzf.o): In function `bgzf_dopen':
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:160: undefined reference to `compressBound'
samtools/libbam.a(bgzf.o): In function `bgzf_open':
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:142: undefined reference to `compressBound'
samtools/libbam.a(bgzf.o): In function `inflate_block':
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:224: undefined reference to `inflateInit2_'
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:228: undefined reference to `inflate'
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:229: undefined reference to `inflateEnd'
/home/dobin/STARcode/samtools-0.1.19/bgzf.c:233: undefined reference to `inflateEnd'
samtools/libbam.a(bam_import.o): In function `ks_getuntil2':
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:17: undefined reference to `gzread'
samtools/libbam.a(bam_import.o): In function `__bam_get_lines':
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:76: undefined reference to `gzdopen'
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:92: undefined reference to `gzclose'
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:76: undefined reference to `gzopen64'
samtools/libbam.a(bam_import.o): In function `sam_close':
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:485: undefined reference to `gzclose'
samtools/libbam.a(bam_import.o): In function `sam_open':
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:472: undefined reference to `gzdopen'
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:472: undefined reference to `gzopen64'
samtools/libbam.a(bam_import.o): In function `sam_header_read2':
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:126: undefined reference to `gzdopen'
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:126: undefined reference to `gzopen64'
samtools/libbam.a(bam_import.o): In function `ks_getc':
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:17: undefined reference to `gzread'
samtools/libbam.a(bam_import.o): In function `sam_header_read2':
/home/dobin/STARcode/samtools-0.1.19/bam_import.c:147: undefined reference to `gzclose'
collect2: ld returned 1 exit status
make: *** [STAR] Error 1

I have samtools-0.1.19 in my computer. what was this error about? thank you.

[alexdobin]

Hi Shangzhong,

please try one of the latest STAR patches.
Do you have a large number of contigs/scaffolds in your genome assembly? This would explain the error message (see this post). If so, you need to use --genomeChrBinNbits 14 or smaller.

You can find brief description of all parameters at the end of the manual, or in the parametersDefault file in the source directory. If you want to use annotations to improve mapping accuracy, you will need:

sjdbGTFfile -
string: path to the GTF file with annotations

sjdbOverhang 0
int>=0: length of the donor/acceptor sequence on each side of the junctions, ideally = (mate_length - 1)
if =0, splice junction database is not used

Cheers
Alex

[shangzhong0619]

failed to generate genome using STAR

Hi, I build genome using command:
STAR --runMode genomeGenerate --genomeDir STAR_pathway --genomeFastaFiles file.fa.gz --runThreadN 10
Then I failed and got message: "BUG: next index is smaller than previous, EXITING".

Also, does anyone have more detailed manual of STAR, I downloaded the manual from the website, it shows /pathToStarDir/STAR --runMode genomeGenerate --genomeDir /path/to/
GenomeDir --genomeFastaFiles /path/to/genome/fasta1 /path/to/genome/
fasta2 --runThreadN <n> …
What are the other opions in ...? I tried unzip the fa.gz file to fa file and then got the the wrong message: "limitGenomeGenerateRAM=28is too small for your genome
SOLUTION: please specify limitGenomeGenerateRAM not less than114 GB and make that much RAM available".

For other aligners we can type -h or --help to find the details, but not for star...