Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • kopo3
    Junior Member
    • Oct 2009
    • 3

    Question on QuEST

    Hello, all.

    I am trying to process our ChIPseq data using QuEST.


    I have managed to compile the program and succeeded in processing the sample data on the homepage above.
    However, when I tried to do the same thing with our data, QuEST displays errors and I cannot process the data.

    Below is several lines of our data,
    GGTGCCCTGCTTCCTTGCCATTCCAGCCATGCCTGA 0 0 chr6:136088939 F
    GTTTAGCAGTGGTTCCAGAGGACTTAATAGACAGAA 0 0 chr6:43415552 F
    TAAACTCTTACAACCTAAAGCTCTAAGTCCTTAGGA 0 0 chr13:86619993 F

    and this is the error that I keep getting.
    . Skipping.pected +/- for orientation of read but found F
    . Skipping.pected +/- for orientation of read but found F
    . Skipping.pected +/- for orientation of read but found F

    What is wrong with our data? I hope some of you can help us out.
    Thanks in advance.
  • Xi Wang
    Senior Member
    • Oct 2009
    • 317

    #2
    Originally posted by kopo3 View Post
    Hello, all.

    I am trying to process our ChIPseq data using QuEST.


    I have managed to compile the program and succeeded in processing the sample data on the homepage above.
    However, when I tried to do the same thing with our data, QuEST displays errors and I cannot process the data.

    Below is several lines of our data,
    GGTGCCCTGCTTCCTTGCCATTCCAGCCATGCCTGA 0 0 chr6:136088939 F
    GTTTAGCAGTGGTTCCAGAGGACTTAATAGACAGAA 0 0 chr6:43415552 F
    TAAACTCTTACAACCTAAAGCTCTAAGTCCTTAGGA 0 0 chr13:86619993 F

    and this is the error that I keep getting.
    . Skipping.pected +/- for orientation of read but found F
    . Skipping.pected +/- for orientation of read but found F
    . Skipping.pected +/- for orientation of read but found F

    What is wrong with our data? I hope some of you can help us out.
    Thanks in advance.
    I am wondering if you used the option -solexa_align_ChIP followed by your input file.
    Xi Wang

    Comment

    • kopo3
      Junior Member
      • Oct 2009
      • 3

      #3
      Thanks for the reply.

      Originally posted by Xi Wang View Post
      I am wondering if you used the option -solexa_align_ChIP followed by your input file.
      Dear Wang.

      Thank you for your quick reply.
      Actually, the command line I used was,

      ./generate_QuEST_parameters.pl -solexa_align_ChIP ./data_file.txt -gt ./genome_table -ap ./QuEST_analysis -ChIP_name DBF_CELL

      Curiously, when I carried the command out in a cygwin environment, I did not encounter this error, although in the latter part of the process, the program ceased to work due to another error.
      However, when I carried it out on a 64bit Fedora9 environment (in which I was successful in processing the sample file on the original homepage) I got this error.
      Do you have any idea what is wrong with the data, or command line?

      Comment

      • Xi Wang
        Senior Member
        • Oct 2009
        • 317

        #4
        Originally posted by kopo3 View Post
        Dear Wang.

        Thank you for your quick reply.
        Actually, the command line I used was,

        ./generate_QuEST_parameters.pl -solexa_align_ChIP ./data_file.txt -gt ./genome_table -ap ./QuEST_analysis -ChIP_name DBF_CELL

        Curiously, when I carried the command out in a cygwin environment, I did not encounter this error, although in the latter part of the process, the program ceased to work due to another error.
        However, when I carried it out on a 64bit Fedora9 environment (in which I was successful in processing the sample file on the original homepage) I got this error.
        Do you have any idea what is wrong with the data, or command line?

        That is quite abnormal. Waiting for the author to answer...

        Days ago, I also encountered an error when running QuEST 2.4. I think it would be a common problem. So I post it here.

        I found that in the file "run_QuEST_with_param_file.pl": Line 742
        my $pseudo_ChIP_scores_path = $scores_path . "/pseuod_ChIP";

        there is a misspelling: "/pseudo_ChIP" instead of "/pseuod_ChIP".

        This misspelling will cause the program stoped with an error message:
        >> bad file name: ./scores/pseudo_ChIP/chr1.score
        >> run_generate_profile_with_param_file.pl: Caught an error message (code 256), passing error message to the top script.
        >> run_QuEST_with_param_file.pl: Caught an error message (code 768) when running generate_pseudo_ChIP_profile. Aborting.
        Last edited by Xi Wang; 10-30-2009, 10:21 PM.
        Xi Wang

        Comment

        • kopo3
          Junior Member
          • Oct 2009
          • 3

          #5
          The original file that I had was an eland-extended file.
          I converted the file so that it was similar to the example file.
          I noticed that I could use an option so that QuEST can analyze eland-extended files and it worked!
          So, although I still do not know why QuEST could not handle the file I converted, it seems that I can use QuEST to analyze files that we have.

          Thank you!

          Comment

          • Anton
            Junior Member
            • Nov 2009
            • 2

            #6
            Hi kopo3, my guess is that the solexa align file is messed up in some way, e.g. has tab as a separator instead of a space.

            Xi, thanks for catching the pseudo_ChIP typo - I had fixed this bug and posted a new version on my web site:


            Here's the direct link:


            Very best! Anton.
            Last edited by Anton; 11-03-2009, 01:06 PM.

            Comment

            • ikrier
              Member
              • Dec 2009
              • 19

              #7
              Problem using quest with illumina 1.3+ files

              Hi,
              What is the option for using eland_extended files as input? I have alignment files of the latest format (1.5.1 pipeline version). They look like this :
              R2D2 1 5 12 894 524 1 AGAGAGCAGGCTGAGACTACTAGGTGTGGGCAT eegggefgggfegeggggf`gTLTLITNPRSff chr10 3002722 F 3C29 55
              R2D2 1 5 31 1197 1453 1 AGAGAGCAGGCTGAGACTACTAGGTGTGGGCAT ggggggdgghegcggghggfggegcgfdgc chr10 3002722 F 3C29 57

              It doesn't seem to be recognized in default mode. From the manual I have, something different is expected. I can reformat the files to extract the info, but if there's an option already there, it'd be so much easier.

              Comment

              • Anton
                Junior Member
                • Nov 2009
                • 2

                #8
                Folks, please post your questions regarding QuEST into the QuEST Google group:



                It is much easier for me to handle questions there.
                Much appreciated!
                Best, Anton.

                Comment

                • Bioinfo
                  Member
                  • Jul 2010
                  • 15

                  #9
                  Hi all,
                  Do anyone has experience with Quest for chipseq data analysis. anyone can suggest how to use eland alignment files(export/sorted). however i tried and met some errors as posted above.
                  thanks in advance

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                    by SEQadmin2


                    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


                    Here are nine questions we think about, in roughly the order they matter, before...
                    06-18-2026, 07:11 AM
                  • SEQadmin2
                    From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                    by SEQadmin2


                    Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                    The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                    ...
                    06-02-2026, 10:05 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 06-17-2026, 06:09 AM
                  0 responses
                  24 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 06-09-2026, 11:58 AM
                  0 responses
                  41 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 06-05-2026, 10:09 AM
                  0 responses
                  48 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 06-04-2026, 08:59 AM
                  0 responses
                  49 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...