Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • tomjan
    Junior Member
    • Apr 2012
    • 8

    #1

    base quality encoding changed after "bwa samse" command

    hello,

    Please look at base quality string in my sample2New.fq file


    @EBRI093151_0051:4:55:2998:9540#0/1
    ACAACACAGTGGGTTGGAGTAGAGCATCTCCAAAGGCCCTTTCCAATCCAACATGAGTAACTCAAGCTCTGCACCAGCCACGAAAAGGCAAGGCTTTGGAT
    +
    FFFFFFFFFFDFFBFDEAEEEFFFFFFFFCFFEFFCEEEDDFFEEEFEADDFDFDEEDFFE@FCDDD>ACDFADD?CCECDB<?@047:9@?BB+B@@@]]



    after commands

    opt/bwa-0.6.2/bwa index -a bwtsw -p ref reference.fa
    /opt/bwa-0.6.2/bwa aln -t 10 -f sample2New.sai -I ref sample2New.fq
    /opt/bwa-0.6.2/bwa samse -f sample2New.sam -r "@RG\tID:sample2\tPL:ILLUMINA\tPUu1\tLB:sample2\tSM:sample2" ref sample2New.sai sample2New.fq



    I can see changed base quality string in the sample2New.sam file

    EBRI093151_0051:4:55:2998:9540#0 0 Chr10 377653 0 101M * 0 0 ACAACACAGTGGGTTGGAGTAGAGCATCTCCAAAGGCCCTTTCCAATCCAACATGAGTAACTCAAGCTCTGCACCAGCCACGAAAAGGCAAGGCTTTGGAT ''''''''''%''#'%&"&&&''''''''$''&''$&&&%%''&&&'&"%%'%'%&&%''&!'$%%%^_"$%'"%% $$&$%#^] !^Q^U^XESC^Z! ##^L#!!!>> RG:Z:sample2 XT:A:R NM:i:0 X0:i:3 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:101 XA:Z:Chr10,+33,101M,0;Chr10,+242847,101M,0;


    and ofcourse the command

    java -Xmx8g -jar /opt/picard-tools-1.85/SortSam.jar SO=coordinate INPUT=sample2New.sam OUTPUT=sample2New.bam VALIDATION_STRINGENCY=LENIENT CREATE_INDEX=true


    fails with error

    Exception in thread "main" java.lang.IllegalArgumentException: Invalid fastq character:

    Why "bwa samse" is changing quality encoding??
    Do you have an idea what Im doing wrong?

    thanks
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    Could you edit your post to use the [ code ] and [ /code ] tags? This is easily done via the advanced editor view where there is a button for this in the tool bar (not shown in the quick reply edit box).

    Comment

    • maubp
      Peter (Biopython etc)
      • Jul 2009
      • 1544

      #3
      I've not checked all the bases (due to the forum formatting), however, it would appear to be down to a FASTQ encoding problem. It appears bwa defaulted to assuming the obsolete Illumina specific ASCII encoding of PHRED+64, while your data was actually the original standard Sanger ASCII encoding of PHRED+33 (now adopted by Illumina). For background, see:
      http://dx.doi.org/10.1093/nar/gkp1137

      In your FASTQ file, the first base has quality code 'F', ASCII character 70. Under the Sanger FASTQ scheme that means 70-33 = quality 37. However, if read in as the obsolete Illumina scheme it would be 70-64 = 6 quality, which when output again in SAM format (which uses the Sanger FASTQ scheme) becomes 6+33 = ASCII 39 = ' (single quote).

      Solution - there is a command line option to tell bwa you have a Sanger style FASTQ file. Use it, otherwise you get a bad SAM/BAM file.

      Comment

      • tomjan
        Junior Member
        • Apr 2012
        • 8

        #4
        Thank you for your help Maubp,

        Your explanations helped me to find the solutions

        The problem was in "bwa aln" cmmand
        /opt/bwa-0.6.2/bwa aln -t 10 -f sample2New.sai -I ref sample2New.fq

        from the documentation we can se "-I The input is in the Illumina 1.3+ read format (quality equals ASCII-64). ". So, everything is OK when I ommit the -I option.

        /opt/bwa-0.6.2/bwa aln -t 10 -f sample2New.sai ref sample2New.fq


        Once again, Thank You for your help.

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #5
          Well done - and thank you for posting back with the details for anyone searching about this again in the future.

          (I couldn't remember the details about the switch, and wasn't at a machine where I could quickly check - but this way you'll probably remember the problem and solution )

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 08-06-2026, 07:41 AM
          0 responses
          15 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-03-2026, 10:13 AM
          0 responses
          31 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          41 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          26 views
          0 reactions
          Last Post SEQadmin2  
          Working...