Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • nasepu
    Junior Member
    • Sep 2012
    • 5

    Interrogate .fq file for specific sequence?

    I found a very suspect major snp when digging through my sequence data, identical to a construct I've previously made in the lab. I'm concerned this is contamination, and it has too significant a phenotype to be ignored. The best way I could think to check if the plasmid somehow made its way in is to check for other stuff that would be on a plasmid, like ampicillin or kanamycin resistance.

    I'm unsure what the best way to go about this is. I briefly tried aligning the entire .fq file against the amp gene sequence, which threw an error that can probably be fixed, but the whole idea of trying to align billions of reads against one tiny gene rubbed me the wrong way. Is there a better way to go about this/any tools that would be more useful?
  • Bukowski
    Senior Member
    • Jan 2010
    • 388

    #2
    On the grounds of 'right tool for the right job' using an aligner specifically designed to align ngs reads to a sequence seems like the right way to go to me, as it's likely to be faster than (e.g.) BLAT.

    With such a small search space it doesn't seem like the job would take that long - why not try aligning to the vector sequence not just the gene?

    Comment

    • swbarnes2
      Senior Member
      • May 2008
      • 910

      #3
      Try:

      Code:
      grep AGTTAGCTCTCGATAGGCTAT read1.fq
      For whatever sequence you are looking for.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      26 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      37 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      24 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      34 views
      0 reactions
      Last Post SEQadmin2  
      Working...