Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Bulak
    Junior Member
    • Jun 2012
    • 3

    bowtie2 gapped alignment

    Hi, I am trying to map some short RNA-Seq reads from mouse against genome (mm10)/transcriptome sequences using bowtie2. There is a particular case which I couldn't resolve. Briefly, bowtie2 is not able to find an alignment for a read of length 33 which in fact can align against the genomic sequence with a single gap roughly in the middle of the read sequence.

    HTML Code:
    Query  1   ATACGTCCTCTATC-GAGGACAATATATTAAATG  33
               |||||||||||||| |||||||||||||||||||
    Sbjct  64  ATACGTCCTCTATCCGAGGACAATATATTAAATG  97
    When this gap is corrected by hand, then bowtie2 finds the match. To be more specific the particular sequence is from a U2 ncRNA and a tiny fastq format is attached. The second read in the same file is a faux read created by changing the ID of the first one and filling in the gap by hand.
    I have tried bowtie2 with several parameters:
    --very-sensitive
    -L 10 -D 20 -R 20 -N 0 -i S,1,0.5
    -L 10 -D 20 -R 20 -N 1 -i S,1,0.5
    -L 10 -D 20 -R 20 -N 0 -i S,1,0.5 --rdg 1,1
    -L 6 --score-min=C,-60,0
    -L 6 --score-min=C,-100,0

    Only in the last one, I started to get some horribly bad misalignments, but not the aimed alignment with one gap. Can someone explain what I am missing? Thanks for any comments/suggestions.
    Attached Files

Latest Articles

Collapse

  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-20-2026, 11:10 AM
0 responses
14 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
32 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
43 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
29 views
0 reactions
Last Post SEQadmin2  
Working...