Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Layla
    Member
    • Sep 2008
    • 58

    #1

    Reliability

    I am comparing the output from Bowtie and maq and using the command below I get a total of 147-e6 alignments for 34-e6 reads. After rigorous filtering, I have half the numbers of reads mapped to chr1 as I did using maq. One of the issues is this:
    HWI-EAS261:6:61:525:1199#0/2 - gi|89161185|ref|NC_000001.9|NC_000001 78 TAACCCTAACCCTAACCCTAACCCTAACCCAACCCTAACCCTAAC
    HWI-EAS261:6:61:525:1199#0/2 + gi|89161205|ref|NC_000003.10|NC_000003 199384671 GTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA

    Maq flags the second alignment with an MAQ score<10 and is thus easy to eliminate maintaining the 1st alignment.
    Is it possible to know which alignment is correct from Bowtie?

    ./bowtie -t h_sapiens_asm -1 sanger1.fq -2 sanger2.fq -n 2 -l 28 -e 70 -I 0 -X 250 -a > output.txt --un unmapped_reads.fq --al reads_at_least_1_alignment.txt
    #Reported 73,823,285 paired-end alignments to 1 output stream(s)

    Layla
  • Ben Langmead
    Senior Member
    • Sep 2008
    • 200

    #2
    Hi Layla,

    If filtering of repetitive alignments is what you're after, take a look at the -m and --strata options. Together, these options allow you to define what hits count as "repetitive", then filter them out. The --max option additionally diverts the repetitively-aligned reads to a separate output file.

    Also, I can't see how you're running Maq, but you might be in a situation where you'd actually like to run Bowtie in unpaired mode separately on your two mate inputs. I say this because the Maq output you show seems to have aligned the mates to separate chromosomes. Perhaps I'm misinterpreting.

    Thanks,
    Ben

    Comment

    • Layla
      Member
      • Sep 2008
      • 58

      #3
      Hi Ben,

      Thanks for your reply. I've got myself a little muddled with the output. I used the -m1 -k1 option but I was worried I might be missing reads that had 1MM or 2MM as these would go unreported. Hence I asked everything to be reported and will clean the data myself. I will re-align the unmapped reads using unpaired option. The above command for 34-e6 reads (17-e6 reads per file) took 6hours on a 32GB machine, is this reasonable?

      I might get back to you once I have looked at the output some more.

      Thanks,
      L

      Comment

      • Layla
        Member
        • Sep 2008
        • 58

        #4
        Quick question,

        How does Bowtie deal with paired end reads where both ends align to different chromosomes? I believe maq gives various flags to identify such reads.

        Thanks,
        L

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          New Genomics Technologies Take Aim at Long-Standing Limits
          by SEQadmin2


          Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

          We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
          ...
          Today, 10:25 AM
        • SEQadmin2
          How Immunogenomics Decodes Immunity’s Genetic Blueprint
          by SEQadmin2




          The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

          This convergence of genetics, immunology, and computation...
          09-01-2026, 05:41 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 09-25-2026, 09:06 AM
        0 responses
        27 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 09-23-2026, 11:05 AM
        0 responses
        24 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 09-18-2026, 11:37 AM
        1 response
        46 views
        0 reactions
        Last Post pekgio
        by pekgio
         
        Started by SEQadmin2, 09-16-2026, 10:23 AM
        1 response
        55 views
        0 reactions
        Last Post pekgio
        by pekgio
         
        Working...