Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • NitaC
    Member
    • Apr 2013
    • 17

    #1

    procedure for extracting raw read counts

    Good morning everyone.

    I am a newb and this is my first time touching any sequencing data. It just so happens that the best way to learn is to dive right in. Incidentally I have hit a bit of a stumbling block and was hoping someone here could shed some light on it.

    I am trying to extract the raw read counts for transcripts mapped only to the forward strand. The mapping was done using Gsnap (I did not do the mapping.) We did paired-end sequencing using Illumina's HiSeq platform. Again, this was my first time working with sam/bam files and it took some time to understand the formats. Here is what I did:

    To get only the forward read counts I took the sam file I was supplied and converted it back to a bam file. Then using the 0x0040 flag I used a command to get just the forward reads and redirected that output to another sam file. Then, looking at column 3 in the sam file, I saw either the name of the transcript or a *. It is my understanding that the "*" is for those reads that did not align. So I wrote a little bash script to filter those out. I was told by a co-worker that using column 3 I could get the raw counts of the mapped transcripts. So, I wrote another little script to do that. I know my script is working correctly, however, my numbers do not match the numbers my co-worker has. In fact, I have counts for some transcripts that my co-worker reported as not detected at all. I know there are tools to automatically get counts, but I want to actually understand these file formats before using some black box of tools.

    This is how one line looks in the sam file:
    [anitabow@kirby2 spikeIn]$ head -n 35 DR38spikeInForward.sam|tail -n 1
    FCC1WG7ACXX:5:1101:3115:1979#GGACCCAT 99 ERCC-00130 851 40 100M = 958 207 CTTGAAGCAGATGATATCCCGATGCTGACGGCTTACAATAAACGTGATCAAAAACTGCCTGATTTTATACCGACCGCCGGAAGGGATCACATTATGGTCA CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJIFFHHDGIJIJDEHJIIJJJJIHHIJJHHHHHHHFFFFFDDDDDDDDDDDDDDDDDDDDDDEDDCCD MD:Z:100 NH:i:1 HI:i:1 NM:i:0 SM:i:40 XQ:i:40 X2:i:0

    As you can see, the third column has the name of one transcript. This is what I have been using to extract my counts. So basically, my script will count every time it sees ERCC-00130 for example.

    Thanks in advance for any help.
    Last edited by NitaC; 04-29-2013, 05:57 AM. Reason: added an example of what I was talking about
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    You need to read more about the FLAG field in SAM/BAM. Here bits 0x4 and 0x10 will tell you if a read is mapped and to which strand.

    You can't just look at column 3 (RNAME), as that can be a reference name if the read's mate was mapped even if the read itself was not.

    Comment

    • NitaC
      Member
      • Apr 2013
      • 17

      #3
      Hi maubp!

      It is my understanding that 0x4 tells you that the read was unmapped and that 0x10 indicates that the read is on the reverse strand. I don't think either of those flags really address my issue. I've already filtered for unaligned reads.

      And I'm not sure I understand your second response. If I've filtered out unaligned reads and filtered for only the forward strand, ultimately I still need some sort of reference name or gene id to count right? Are you saying that after filtering for forward reads, there may still be reads in my results that have not actually mapped to the forward strand but are listed because their mate did?

      As it turns out, my little pipeline actually matches the results using htseq-count so I'm a little more confident in what I did. And my co-worker's counts were from one sample whereas mine were from all the samples combined. That little tidbit would've saved me from a lot of headaches.

      Comment

      • maubp
        Peter (Biopython etc)
        • Jul 2009
        • 1544

        #4
        Originally posted by NitaC View Post
        Are you saying that after filtering for forward reads, there may still be reads in my results that have not actually mapped to the forward strand but are listed because their mate did?
        Yes in general. This is deliberate so that when coordinate sorted the unmapped read is next to its mapped partner in the BAM file. See "Recommended Practise for the SAM format" in the specification. Also "Bit 0x4 is the only reliable place to tell whether the segment is unmapped".

        Comment

        • NitaC
          Member
          • Apr 2013
          • 17

          #5
          Ohhh, good to know. Thank you.

          Comment

          • Simon Anders
            Senior Member
            • Feb 2010
            • 995

            #6
            Also, remember that a read that aligns to multiple places will be listed in multiple lines in the SAM file.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
              by SEQadmin2



              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

              Despite this, “CRISPR helped turn genome editing from a specialized technique into
              ...
              07-31-2026, 11:01 AM
            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 08-06-2026, 07:41 AM
            0 responses
            18 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-03-2026, 10:13 AM
            0 responses
            33 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-31-2026, 02:55 AM
            0 responses
            43 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-24-2026, 12:17 PM
            0 responses
            26 views
            0 reactions
            Last Post SEQadmin2  
            Working...