Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • dzmtnvmt
    Member
    • Apr 2010
    • 11

    How to processing ENCODE small RNA-seq data

    Here is a problem when processing CshlShortRnaSeq data from ENCODE.

    For example, for 1*36bp Gm12878, I found the adaptor or primer sequence of small RNA library were:
    -------------------------------------------------------------------
    5’SBS3_Adapter (This is the RNA ligated onto the 5’ end): “r” = ribose, RNA base
    5’- rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU
    A-Tail RT Primer (This is the primer used in the RT reaction):
    5’-TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTTTTTTTTTTTVN
    PE 5’ PCR (PCR Primer):
    5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC
    PE 3’ PCR (PCR Primer):
    5’-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTC
    ----------------------------------------------------------------------

    but I found that there were few reads with the adaptor on the 5' side, but rather, there are many "AGATCGGTTGT*" (the reverse of 5'adaptor) after the ployA in the 3' side. So, I am not sure if it would be correct if I clip the 5'SBS3_adaptor and 3'ploy A, and process those data accuratly using aligners such as Bowtie.

    I will be appreciative if anyone could help~
  • alexdobin
    Senior Member
    • Feb 2009
    • 161

    #2
    At the 3' ends of your reads you should see the reverse complementary to the A-Tail RT Primer sequence: 5’-TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTTTTTTTTTTTVN
    i.e.
    AAAAAAAAAAAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGA

    We trimmed any sequence that contained AAAAAA (6As). This is a very aggressive trimming - we hoped to get rid of all the genomic A-homopolymer priming sites. STAR can do it for you with:
    --clip3pAdapterSeq AAAAAA --clip3pAdapterMMp 0

    Comment

    • dzmtnvmt
      Member
      • Apr 2010
      • 11

      #3
      Originally posted by alexdobin View Post
      At the 3' ends of your reads you should see the reverse complementary to the A-Tail RT Primer sequence: 5’-TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTTTTTTTTTTTVN
      i.e.
      AAAAAAAAAAAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGA

      We trimmed any sequence that contained AAAAAA (6As). This is a very aggressive trimming - we hoped to get rid of all the genomic A-homopolymer priming sites. STAR can do it for you with:
      --clip3pAdapterSeq AAAAAA --clip3pAdapterMMp 0

      Thanks for your reply. Do you imply that the 5'SBS3_adaptor has already been trimmed in the raw fastq data?
      BTY, I found that the 5’SBS3_Adapter and A-tail primer all have "CGCTCTTCCGATCT". Is there any meaning from this?

      Comment

      • alexdobin
        Senior Member
        • Feb 2009
        • 161

        #4
        Under normal conditions, the 5' adapter does not get sequenced - the sequencing starts from the 1st base of the RNA sequence. The only sequence you have to worry about is the 3' adapter.

        Comment

        • dzmtnvmt
          Member
          • Apr 2010
          • 11

          #5
          Got that, thank you!

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
            by SEQadmin2


            Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


            The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
            ...
            06-02-2026, 10:05 AM
          • SEQadmin2
            Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
            by SEQadmin2


            With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


            Introduction

            Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
            05-22-2026, 06:42 AM
          • SEQadmin2
            Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
            by SEQadmin2

            Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


            Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
            05-06-2026, 09:04 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Today, 08:59 AM
          0 responses
          8 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-02-2026, 12:03 PM
          0 responses
          21 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-02-2026, 11:40 AM
          0 responses
          15 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 05-28-2026, 11:40 AM
          0 responses
          29 views
          0 reactions
          Last Post SEQadmin2  
          Working...