Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • NateP
    replied
    Wei,

    I figured it was something along those lines.
    The newest version works with my data sets, thanks for the great program!

    Leave a comment:


  • shi
    replied
    Dear @NateP,

    featureCounts had hard-coded limits on the numbers of chromosome allowed to be included in the annotation file and in the BAM/SAM file. These limits were far less than the number of contigs you have here and that was the reason why featureCounts crashed.

    We have now removed these limits and allowed any number of chromosomes (or contigs) to be included in the annotation file and in the SAM/BAM file. Please check out the latest version of the Subread package (1.3.3-p2) on sourceforge. The featureCounts program included in this version should work for your data now.

    Please let me know if the problem persists.

    Best wishes,

    Wei

    Leave a comment:


  • NateP
    replied
    I don't know if this an intentional limitation to the program, but here is an error I'm encountering.

    The reference genome I am aligning reads to is a draft version, with 430k contigs.

    The error I am getting when attempting to use featureCounts is:

    "There are 290343 features loaded from the annotation file.
    WARNING: THere are too many chromosomes in the annotations. The remainder of the annotation file is ignored.
    The 8586 features are sorted.
    Number of chromosomes inclued in the annotation is 499.

    WARNING: There are too many reference sequences in the BAM file!
    [repeated many times]
    Segmentation fault"

    Leave a comment:


  • shi
    replied
    Dear dietmar,

    Although you got those warning messages, your annotation file was actually successfully processed according to the program output (sorry for the misleading warning message about gene id, we have fixed this and updated the program on sourceforge).

    Did you provide a SAM or BAM file to featureCounts? If you provided a BAM file, you need to add an '-b' option to your command. Otherwise it will cause a segmentation fault.

    We actually downloaded the ENCODE annotation file you used and tested it here. We found it worked with the version of featureCounts you are using for both SAM and BAM input.

    Could you please check if you correctly specified the type of your read file? I think this was probably the reason why you got a segmentation fault.

    Best regards,

    Wei

    Leave a comment:


  • dietmar13
    replied
    dear wei,

    thank you.

    but now i get another error:

    Code:
    **********
    **********
      WARNING
    **********
    No meta-feature id is found on the 6-th line. If it is a GTF file, you may need to check the name of the gene_id field and specify a correct field name using a '-g' option.
    **********
    **********
    WARNING: the feature on the 31178-th line has zero coordinate or zero lengths
    ... many similar warnings ...
    WARNING: the feature on the 2577002-th line has zero coordinate or zero lengths
    There are 1201574 features loaded from the annotation file.
    The 1201574 features are sorted.
    Number of chromosomes included in the annotation is 25
    ./count_featurCount.sh: line 16: 24368 Segmentation fault      (core dumped) featureCounts -p -B -C -a $gtf -t exon -g gene_id -i $SAMdir/$name/RUM.sam -o $name.fcount

    the 6th line has definitely a gene_id (probably a bug?) but the lines with zero length features are true.

    the gtf-file:
    Code:
    ##description: evidence-based annotation of the human genome (GRCh37), version 15 (Ensembl 70)
    ##provider: GENCODE
    ##contact: [email protected]
    ##format: gtf
    ##date: 2013-01-21
    chr1	HAVANA	gene	11869	14412	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENSG00000223972.4"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "pseudogene"; transcript_status "KNOWN"; transcript_name "DDX11L1"; level 2; havana_gene "OTTHUMG00000000961.2";
    chr1	HAVANA	transcript	11869	14409	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENST00000456328.2"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "DDX11L1-002"; level 2; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
    ...
    31178-th line:
    chr1	HAVANA	exon	19983359	19983359	.	+	.	gene_id "ENSG00000158747.9"; transcript_id "ENST00000439278.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "NBL1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "NBL1-007"; exon_number 4;  level 1; tag "mRNA_end_NF"; tag "cds_end_NF"; tag "exp_conf"; havana_gene "OTTHUMG00000002700.5"; havana_transcript "OTTHUMT00000313743.1";
    do you think the zero-length features are the problem, or is it possible that if the BAM files has additional chromosomes (like chr1_gl000191_random) which are not present in the gtf-annotation file your program has a problem. i think this should be catched, because this will happen often...

    best wishes,

    dietmar

    Leave a comment:


  • shi
    replied
    Hi dietmar,

    We have fixed this and uploaded the latest version (v1.3.3-p1) to sourceforge (http://subread.sourceforge.net).

    Hope this works for you.

    Best wishes,
    Wei

    Leave a comment:


  • shi
    replied
    Dear dietmar,

    Thanks for providing the detailed information about the problem you encountered. This helped us to reproduce the problem.

    The featureCounts program does not allow ## lines or comment lines to be included in the provided annotation file. The program crashed when such lines exist in the annotation file. Sorry about this. We are now working on this and will let you know once it is fixed.

    In the meantime, you can get around this problem by removing those ## lines from your annotation file. I have tested this and it worked. Hope it will work for you. But please let me know if it doesn't. I will get back to you soon.


    Best regards,
    Wei

    Leave a comment:


  • dietmar13
    replied
    dear wei,

    using featurecount I
    get:

    Code:
    ./count_featurCount.sh: line 15: 29340 Segmentation fault      (core dumped) featureCounts -p -B -C -a $gtf -t exon -g gene_id -i $SAMdir/$name/RUM.sam -o $name.fcount

    I use:

    Code:
    featureCounts -p -B -C -a $gtf -t exon -g gene_id -i $SAMdir/$name/RUM.sam -o $name.fcount
    example sam file:
    Code:
    seq.1	77	*	0	0	*	=	0	0	CGGGGCGGGATCCCGCCGCCTCTCCGGCCCGCCGGNNNNCCGCCACCGGCCCACTNTNCNCNNCCCCCCCNCGCGG	############################################################################
    seq.1	141	*	0	0	*	=	0	0	NNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNTNNCNGNNTCNNNNNNNNNN	############################################################################
    seq.2	73	chr2	89157089	25	76M	=	89157089	0	CCTCTCTGGGATAGAAGTTATTCAGCAGGCACACANNNNAGGCAGTTCCAGATTTNANCTGNNCATCAGANGGCGG	CCCCCCCDBCCCCBCAABBBCCBCCCCCCCBB@AA####/00000CCCCA##########################	XO:A:F	MD:Z:35ACAG16C1A3CT7T5	NM:i:9	IH:i:1	HI:i:1
    seq.2	133	chr2	89157089	25	*	=	89157089	0	NNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNCNCCNCNNTGCNNNNNNNNN	############################################################################	XO:A:F	IH:i:1	HI:i:1
    seq.3	77	*	0	0	*	=	0	0	CGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTNNNGCAGGAATGCCGAGACCGCNTGTANTCTCGTATGCGGG	BB>4B?>?3>@>@642::<7A#######################################################
    seq.3	141	*	0	0	*	=	0	0	NNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNCNTGNCGNGCGNNNNNNNNN	############################################################################
    seq.4	77	*	0	0	*	=	0	0	CGGTTCACCAGGAATGCCGAGACCGGAAGAGCGGTTCNGCAGGAATGCCGAGACCGCTCGTAATCTCGCATACCGG	<4=.+;**1*45052@@@@@########################################################
    seq.4	141	*	0	0	*	=	0	0	CNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNGNCGNGGNGAGNNNNNNNNN	############################################################################
    and example of the gtf-file (from gencode):
    ##description: evidence-based annotation of the human genome (GRCh37), version 15 (Ensembl 70)
    Code:
    ##provider: GENCODE
    ##contact: [email protected]
    ##format: gtf
    ##date: 2013-01-21
    chr1	HAVANA	gene	11869	14412	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENSG00000223972.4"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "pseudogene"; transcript_status "KNOWN"; transcript_name "DDX11L1"; level 2; havana_gene "OTTHUMG00000000961.2";
    chr1	HAVANA	transcript	11869	14409	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENST00000456328.2"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "DDX11L1-002"; level 2; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
    chr1	HAVANA	exon	11869	12227	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENST00000456328.2"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "DDX11L1-002"; exon_number 1;  level 2; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
    chr1	HAVANA	exon	12613	12721	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENST00000456328.2"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "DDX11L1-002"; exon_number 2;  level 2; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
    chr1	HAVANA	exon	13221	14409	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENST00000456328.2"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_status "KNOWN"; transcript_name "DDX11L1-002"; exon_number 3;  level 2; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
    chr1	ENSEMBL	transcript	11872	14412	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENST00000515242.2"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "unprocessed_pseudogene"; transcript_status "KNOWN"; transcript_name "DDX11L1-201"; level 3; havana_gene "OTTHUMG00000000961.2";
    chr1	ENSEMBL	exon	11872	12227	.	+	.	gene_id "ENSG00000223972.4"; transcript_id "ENST00000515242.2"; gene_type "pseudogene"; gene_status "KNOWN"; gene_name "DDX11L1"; transcript_type "unprocessed_pseudogene"; transcript_status "KNOWN"; transcript_name "DDX11L1-201"; exon_number 1;  level 3; havana_gene "OTTHUMG00000000961.2";
    do you have any clue what could be wrong?

    best wishes,

    dietmar

    Leave a comment:


  • shi
    started a topic featureCounts: a universal read summarization program

    featureCounts: a universal read summarization program

    Dear All,

    I would like to formally introduce to you our featureCounts program, a software program we developed for summarizing the next-gen sequencing reads to genomic features such as genes, exons and promoters.

    featureCounts is a light-weight read counting program written entirely using the C programming language. It can be used to count both gDNA-seq and RNA-seq reads for genomic features. It has the following features:
    (1) It carries out precise and accurate read assignments by taking care of indels, junctions and fusions in the reads.
    (2) It takes less than 4 minutes to summarize 20 million pairs of reads to 26k RefSeq genes using one thread, and only uses 40MB of memory (you can run it on a Mac laptop).
    (3) It supports multi-threaded running, making it extremely fast for summarizing large datasets.
    (4) It supports GTF format annotation and SAM/BAM read data.
    (5) It supports strand-specific read summarization.
    (6) It can perform read summarization at both feature level (eg. exons) and meta-feature level (eg. genes).
    (7) It allows users to specify whether reads overlapping with more than one feature should be counted or not.
    (8) It gives users full control on the summarization of paired-end reads, including allowing them to check if both ends are mapped and/or if the paired-end distances satisfy the distance criteria.
    (9) It discriminates the features, which were overlapped by both ends from the same fragment, from those which were overlapped by only one end so as to get more fragments counted.
    (10) It allows users to specify whether chimeric fragments should be counted.

    For a quick start, have a look at our short tutorial - http://bioinf.wehi.edu.au/featureCounts/ . For more details, please refer to the users guide - http://bioinf.wehi.edu.au/featureCounts/usersguide.pdf (see Chapter 6).

    We also compared featureCounts with other methods. The comparison results can be found in our manuscript - http://arxiv.org/abs/1305.3347.

    The featureCounts program is part of the Subread package (http://subread.sourceforge.net), which includes a suite of programs for processing next-gen sequencing data such as read mapping and exon-exon junction detection. featureCounts can also be accessed from the development version of the Bioconductor R package Rsubread (http://bioconductor.org/packages/2.1.../Rsubread.html)

    Please do not hesitate to contact me if you have any questions ([email protected]).

    Best regards,
    -------------------
    Wei Shi, Ph.D
    Bioinformatics Division
    The Walter and Eliza Hall Institute of Medical Research
    1G Royal Parade, Parkville, Victoria 3052
    Australia
    Last edited by shi; 05-16-2013, 04:08 AM.

Latest Articles

Collapse

  • SEQadmin2
    How Immunogenomics Decodes Immunity’s Genetic Blueprint
    by SEQadmin2




    The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

    This convergence of genetics, immunology, and computation...
    09-01-2026, 05:41 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 09:06 AM
0 responses
16 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-23-2026, 11:05 AM
0 responses
17 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-18-2026, 11:37 AM
1 response
40 views
0 reactions
Last Post pekgio
by pekgio
 
Started by SEQadmin2, 09-16-2026, 10:23 AM
1 response
55 views
0 reactions
Last Post pekgio
by pekgio
 
Working...