Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • crinfante
    Junior Member
    • Oct 2009
    • 5

    #1

    another solexa/phred question

    I am trying to identify what quality format my reads are in, and I can't seem to find a clear answer online. Thanks for the help:

    @HWI-EAS432:1:1:4:99#0/1
    TCTTATCAGTTTAATATCTGATACGTCATCTATTTGAGTACTATATATTAAATGGATTTT
    +HWI-EAS432:1:1:4:99#0/1
    B>;?A8-(:6=A873=A@/:AA18<7(<6:.6=.036&-=<4:2242:=5/<,&3/?16
    @HWI-EAS432:1:1:4:866#0/1
    GGTTTCGCTAGATAGTAGGTAGGGACAGTGGGAATCTCGTTCATCCATTCATGCGCGTCA
    +HWI-EAS432:1:1:4:866#0/1
    83?CCB@ABB@AC?91?9A6>?:9@B?1>7/-<>98;<2<=;B@B6BB?>);.7(7+5BB
    @HWI-EAS432:1:1:4:844#0/1
    TGCTACCCCTCTATTCTGCCATGGTTAGACCACACCTAGAGTATTGTGTCCAATTCTGGG
    +HWI-EAS432:1:1:4:844#0/1
    @1ABBBBACBBBCBAA=/@BBBA1:A@/@BBBB@<@B@4946B@8:>99A3<=??A%%%%
  • kmcarr
    Senior Member
    • May 2008
    • 1181

    #2
    This FASTQ file is standard Sanger quality encoding, which means take the ASCII value of each character in the quality string and subtract 33 from it. The 'highest' character you have is 'C' == 67 and the lowest is '%' == 37. These would translate to Q scores of 34 and 4 which is an expected range of Phred scores.

    The quickest way to distinguish Sanger Q-score encoding (ASCII-33) from Illumina (Solexa) Q-score encoding (ASCII-64) is to look for numerals [0-9] in the quality string. The numerals have ASCII values from 48-57 so it would be non-sensical to subtract 64 from them. If there are numerals in your quality string then the Q-score encoding is Sanger.
    Last edited by kmcarr; 12-02-2009, 02:23 PM.

    Comment

    • crinfante
      Junior Member
      • Oct 2009
      • 5

      #3
      Got it -- thanks for explaining it so clearly.

      Comment

      • crinfante
        Junior Member
        • Oct 2009
        • 5

        #4
        Got it -- thanks for explaining this so clearly.
        Last edited by crinfante; 12-02-2009, 02:05 PM. Reason: duplicate please delete

        Comment

        • MoBi
          Junior Member
          • Dec 2009
          • 4

          #5
          Hello,

          I have a related issue, I don't know in which FASTQ format my reads are?

          @XXX010005.1 BI:080722_SL-XBE_0007_FC3061LAAXX:6:1:1319:692 length=51
          ACGATGTGACGTACGCGTATGCTCGTATACACACGCATGACGAGCGACGAT
          +XXX010005.1 BI:080722_SL-XBE_0007_FC3061LAAXX:6:1:1319:692 length=51
          IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII@I
          @XXX10005.2 BI:080722_SL-XBE_0007_FC3061LAAXX:6:1:395:487 length=51
          TTTTTCGTGTCGGCGGCCCGTCGCCTCTCCACCCCACCACACCCCCCACCC

          Comment

          • Jonathan
            Member
            • Jun 2009
            • 36

            #6
            That would be Illumina/Solexa Fastq;
            But as I can't see the version of the pipeline, it's not possible to tell if this is the new linear fastq metric or the older log-score fastq metric.
            The difference is small, so it shouldn't matter.

            Short question:
            Are all your reads of quality "IIIIII"?
            Strikes me as funny and mayhaps erroneous
            Best
            -Jonathan

            Comment

            • swbarnes2
              Senior Member
              • May 2008
              • 910

              #7
              That's a kind of old Solexa fastq format. (Old being about a year old with this application!) The characters in the quality line ranged from -5 to 40, with ! being 0 and I being 40.

              Fastq format looks like this:

              @read name
              sequence
              +read name again (or just + and nothing, to save file space)
              quality score for each letter in above read

              Comment

              • MoBi
                Junior Member
                • Dec 2009
                • 4

                #8
                Many thanks Jonathan and swbarnes2.

                Yes actually frankly most of my reads are with quality values of IIII!

                So I'm trying to use VAAL in order to assemble several bacterial genomes to a reference and detect SNPs, VAAL requires that I convert these FASTQ files into .fasta and .qual.

                Do you know an easy way of doing that, given that I'm not an expert in bioinformatics?!

                I tried this one:


                But it keeps giving me errors.

                Thanks a lot!

                Comment

                • maubp
                  Peter (Biopython etc)
                  • Jul 2009
                  • 1544

                  #9
                  Originally posted by MoBi View Post
                  I tried this one:


                  But it keeps giving me errors.

                  Thanks a lot!
                  I'm pretty sure from the format names etc that this website is using Biopython internally to do the conversion. However, it looks like there is a bug in the website with quotes (which can occur in FASTQ quality strings) being "escaped" with extra slash characters. As a result, the data given to Biopython is corrupted, and the conversion fails.

                  You would be better off using Biopython directly (especially for large files, it would be silly to try and upload/convert/download anything bigger than a few megabytes).

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                    by SEQadmin2



                    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                    Despite this, “CRISPR helped turn genome editing from a specialized technique into
                    ...
                    07-31-2026, 11:01 AM
                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 08-13-2026, 12:22 PM
                  0 responses
                  26 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-11-2026, 10:35 AM
                  0 responses
                  22 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-06-2026, 07:41 AM
                  0 responses
                  36 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-03-2026, 10:13 AM
                  0 responses
                  51 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...