First I'm running the most recent versions of TopHat2 and Samtools (2.0.8b , .19 respectively).
I'm getting the following errors being thrown from long_spanning_reads:
I've looked at the possible offending reads and the CIGAR codes and length of the reads all appear to be in line with each other.
I've spent the day digging around the source code trying to figure out where exactly in the program the problems being thrown in an attempt to make manual corrections to the offending reads (or remove them if need be) within the pipeline so I can simply resume the run.
Unfortunately I've been unable to find a solution that is reasonable.
Has anyone else encountered this problem and gotten a proper solution ?
I'm getting the following errors being thrown from long_spanning_reads:
Code:
Error: CIGAR and sequence length are inconsistent!(GGCGTCTCGGTCGTCGGCTCCGGCGGGTACGTGTAGGGCGTCTCCGTGGTAGGTTCAGGTCCGTGCGTGTATGGCGTCTCGGTCGTCGGCTCCGGCGGGTA)
I've spent the day digging around the source code trying to figure out where exactly in the program the problems being thrown in an attempt to make manual corrections to the offending reads (or remove them if need be) within the pipeline so I can simply resume the run.
Unfortunately I've been unable to find a solution that is reasonable.
Has anyone else encountered this problem and gotten a proper solution ?