Freebayes 0.9.9 problems

[newbietonextgen]

Hello All,

I am trying to run freebayes version 0.9.9 and am having problems. I am used pervious versions and never encountered these problems.

The command is use:

freebayes -XuiP 0.01 -f /path_to_fasta_file -b 40077_sorted_RG.bam -b 40079_sorted_RG.bam -v trial.freebayes.vcf

The output on the terminal: (never seen it doing this before)

GACAGGCCAGGCAGAACAGACGGCTGCTTCATGTCGTCTGTGTCTACAGCAGCTATTGCAAAGGCCCATCCGTACCCCCTGGGATCCTTGAAATGCCCCTTCGGACGTAATCCGTACCGAGTATGCACGGAGCCCCTGGGCCCGTCACGACGGGATGCTTCTGCCGCTCAGTTCAGCGAGGCTCATTTTGGCCTCCAGCGCAGTCAGTCCTTGAGAGCCCCCGTGCGCACCACGAACGCAAAGCCAAACATAGCAAAGACAAACAGGAACAGTACTGCGGCACCTCCCATTGCCGCTCCTCGTACCGACTGAGTCATTATTGCGAGAACTGTGGGCAGCGTTCCCAGACGGCTTTCCGACTACAAATGAGTGCTTTCGGACCCGCTGTGCCCACTGCGGCGTGCCGCTGTTTCTCAGCTTTCCGCCACGACCCCTCCGTGAGGTCCTCGCTAAGAAGAGCGCTC
1:2179
Aborted

The Vcf file shows the first SNP at 1:2179 and then it stops. The bam files (read group, index, started) were used with GATK and worked fine. The output is the same even of i use one bam file to call SNPs

So what am i doing wrong?
Thanks
newbie..

[newbietonextgen]

a little bit of digging around and i see that an error is also posted...

Error: Exception: Cannot read past the end of the alignment's sequence.


So what does this mean? Any ideas?