Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Dario1984
    Senior Member
    • Jun 2011
    • 166

    RNA-seq Mapping to Many Contigs

    What advice do researchers who have previously done RNA-seq on a non-model organism have ? I have RNA-seq data on sea urchin. The current version of the genome has 174772 contigs. I have so far tried generating a genome index with STAR. It used up all of the RAM, and the author said the mapping performance wasn't good on any genomes with more than 50000 contigs. I have also tried de-novo assembly with Trinity, and the number of genes and isoforms found was unrealistically large. Does anyone have a success story to share ?
  • peromhc
    Senior Member
    • Sep 2009
    • 108

    #2
    try filtering out contigs that have a FPKM of less than 1, or .5. This should get rid of a large number of, likely junk, contigs. There are tools in Trinity (RSEM or eXpress) to to this.

    Also, you could try clustering with cd-hit-est to get rid of redundancy.

    Comment

    • shi
      Wei Shi
      • Feb 2010
      • 236

      #3
      Dear Dario1984,

      You may try the Subread aligner which can deal with large number of contigs.



      Best wishes,

      Wei

      Comment

      • Dario1984
        Senior Member
        • Jun 2011
        • 166

        #4
        Thanks for alerting me to the CD-HIT program. I wasn't aware of it. Have you published a journal article using those two steps already ?

        Comment

        • alexdobin
          Senior Member
          • Feb 2009
          • 161

          #5
          Originally posted by Dario1984 View Post
          What advice do researchers who have previously done RNA-seq on a non-model organism have ? I have RNA-seq data on sea urchin. The current version of the genome has 174772 contigs. I have so far tried generating a genome index with STAR. It used up all of the RAM, and the author said the mapping performance wasn't good on any genomes with more than 50000 contigs. I have also tried de-novo assembly with Trinity, and the number of genes and isoforms found was unrealistically large. Does anyone have a success story to share ?
          To avoid RAM problems for the large number of contigs with STAR, try reducing --genomeChrBinNbits (=18 by default) to a smaller number, ~14 or less. The mapping speed will be slow by STAR's standards, but it may still adequate.

          Comment

          • Kennels
            Senior Member
            • Feb 2011
            • 149

            #6
            Originally posted by Dario1984 View Post
            Thanks for alerting me to the CD-HIT program. I wasn't aware of it. Have you published a journal article using those two steps already ?
            This paper should be of good reference:

            Comment

            • Dario1984
              Senior Member
              • Jun 2011
              • 166

              #7
              I used Subread on the data. Because the seed has to be matched exactly, it isn't suitable for mapping to a related organism's genome. 11 % of my reads mapped. I can see it would be great for mapping to a high quality reference genome, such as the human genome sequence.

              Comment

              • Jeremy
                Senior Member
                • Nov 2009
                • 190

                #8
                Most of the reads in the Trinity assembly will be background RNA (something like 80% of the genome is transcribed remember) and assembly junk. As mentioned already mapping the reads to the Trinity assembly and excluding low count sequences will remove this junk. I prefer to use raw read count, then you can easily see what portion of reads map to the 20-40K Trinity sequences you are left with. I have done something like that and from 370,000 trinity sequences, 96% of the reads mapped to about 38,000 trinity sequences and the rest were discarded.

                Comment

                • shi
                  Wei Shi
                  • Feb 2010
                  • 236

                  #9
                  Originally posted by Dario1984 View Post
                  I used Subread on the data. Because the seed has to be matched exactly, it isn't suitable for mapping to a related organism's genome. 11 % of my reads mapped. I can see it would be great for mapping to a high quality reference genome, such as the human genome sequence.
                  Hi Dario,

                  Could you please provide a bit more info about your data such as read length, single-end or paired-end etc? There could be many reasons contributing to a low mappability. Although Subread does not allow mismatches in the seeds, these seeds are quite short (16bp), so I do not really think this was the reason you got a low mapping percentage when mapping your reads to a related species.

                  One thing which may be worthwhile to try is to set -m=1 to test how many reads have a 16bp substring perfectly matched with the reference. If you still got a low percentage, this may simply tell you that your reads are very different from the reference.

                  Best regards,

                  Wei

                  Comment

                  • Wallysb01
                    Senior Member
                    • Feb 2011
                    • 286

                    #10
                    What happens if you only take the 50000 biggest contigs from your reference? A lot of times these draft assemblies have many small contigs that aren't going to contain useful information for gene expression analysis anyway. Meaning they will mostly not contain coding regions, or if they do its only one, maybe two exons, and you can't assign orthology anyway.

                    Comment

                    • Dario1984
                      Senior Member
                      • Jun 2011
                      • 166

                      #11
                      I think the related genome is too distant. I took 100 random reads and used BLAST to get an impression of what the mapping would be like. Two representative examples of one of the 50 base read pairs are

                      Code:
                      >Scaffold915 
                                Length = 323013
                      
                       Score = 42.1 bits (21), Expect = 0.006
                       Identities = 39/45 (86%)
                       Strand = Plus / Plus
                      
                                                                                 
                      Query: 6      ttccagacaaaacagacaacaaatcataatcataaatatcatttg 50
                                    |||| ||||||| ||||||||  || |||| ||||||||||||||
                      Sbjct: 261960 ttcctgacaaaatagacaacatttcttaattataaatatcatttg 262004
                      and

                      Code:
                      >Scaffold476 
                                Length = 632255
                      
                       Score = 40.1 bits (20), Expect = 0.025
                       Identities = 20/20 (100%)
                       Strand = Plus / Minus
                      
                                                        
                      Query: 8      caagaatttttttgatgaaa 27
                                    ||||||||||||||||||||
                      Sbjct: 568677 caagaatttttttgatgaaa 568658
                      I will proceed by implementing the filtering strategies for de-novo assembly.

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        Today, 11:48 AM
                      • SEQadmin2
                        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                        by SEQadmin2



                        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                        ...
                        07-09-2026, 11:10 AM
                      • SEQadmin2
                        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                        by SEQadmin2



                        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                        07-08-2026, 05:17 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, Today, 11:10 AM
                      0 responses
                      8 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-13-2026, 10:26 AM
                      0 responses
                      30 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-09-2026, 10:04 AM
                      0 responses
                      39 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-08-2026, 10:08 AM
                      0 responses
                      25 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...