Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • gwilson
    Junior Member
    • Dec 2009
    • 5

    #1

    Removing multi-matched sequences in Bowtie

    Hello,

    I'm trying to remove multi-matched sequences from my paired-end solexa dataset and could do with a spot of advice.
    I use Bowtie to align my reads and thought that the -m option, if set to -m 1, would remove the multi-matched reads.

    I tested this on a subset of 1000 reads, the stderr can be seen below:

    # reads processed: 1000
    # reads with at least one reported alignment: 561 (56.10%)
    # reads that failed to align: 260 (26.00%) # reads with alignments suppressed due to -m: 179 (17.90%) Reported 561 paired-end alignments to 1 output stream(s)

    This suggests to me that 260 failed to meet the alignment criteria, whilst 179 met the criteria but were matched more than once and so failed to be reported.

    If I was to run the same analysis with the same dataset but remove the -m 1 parameter, I would expect to have 561+179= 740 reported alignments.

    However, in fact I get 827:

    # reads processed: 1000
    # reads with at least one reported alignment: 827 (82.70%)
    # reads that failed to align: 173 (17.30%) Reported 827 paired-end alignments to 1 output stream(s)

    So my question is - what else is the -m flag affecting that could reduce the reported alignments.

    Many Thanks!
  • Xi Wang
    Senior Member
    • Oct 2009
    • 317

    #2
    Could you provide the command line to show us other parameters when running bowtie?
    Xi Wang

    Comment

    • gwilson
      Junior Member
      • Dec 2009
      • 5

      #3
      Yes, sorry:

      bowtie -solexa1.3quals ref_genome -p 4 -S -m 1 -1 read1.fastq -2 read2.fastq

      and

      bowtie -solexa1.3quals ref_genome -p 4 -S -1 read1.fastq -2 read2.fastq


      Thanks

      Comment

      • Xi Wang
        Senior Member
        • Oct 2009
        • 317

        #4
        Your results also confused me... you may check the output to tell us why...
        for suppressed multiple aligned reads you can save them by specifying the parameter --max, and then do a comparison.
        Xi Wang

        Comment

        • gwilson
          Junior Member
          • Dec 2009
          • 5

          #5
          I printed out the unaligned reads (260) when running with -m 1. I have then tried to align these unaligned reads without the -m tag. 173 failed to align (the same number as previously), however the remaining 87 did align. Some examples are shown below:

          HWUSI-EAS492:1:1:7:1425#ATCACG/1 99 7 58333990 255 36M = 58334090 136 ACCGAATCCAAGAACACATTAAAGCAATCATCCATC a`
          ]Z]_^^__\OW]V]XX\[]ZSJ[ZZY[ZW\SSYU XA:i:0 MD:Z:36 NM:i:0
          HWUSI-EAS492:1:1:7:1425#ATCACG/2 147 7 58334090 255 36M = 58333990 -136 AATACATTATATAAACAAACTCAAAGACAAAAACCA ^a
          UHP]]ab`aaaba^ab``_[abba`[abba`_aa XA:i:0 MD:Z:36 NM:i:0
          HWUSI-EAS492:1:1:7:1818#AACACG/2 163 1 153720395 255 36M = 153720562 203 TGTGTGTGTGTGTGTGGTATGTGTGTATGTGTGTGT ab
          abb``baba````_T\L]W``_RVF[`]XWQ_QV XA:i:2 MD:Z:18G7G9 NM:i:2
          HWUSI-EAS492:1:1:7:1818#AACACG/1 83 1 153720562 255 36M = 153720395 -203 GGTGTGTGGTGTGTGGTGTGTGGTGTGTGGTGTGTG `]
          TW]XGZa\^``\b^^a`[O^aa^aa_a`^aa^`` XA:i:0 MD:Z:36 NM:i:0
          HWUSI-EAS492:1:1:7:1783#ATCACG/1 99 9 88890976 255 36M = 88891047 107 AAAATCAGAAATGAAAAGGGAGACATAACAACAGAT aa
          a_`]`X^\`__^__XMNSX^Y^_Y]^[[\_XK^] XA:i:1 MD:Z:4A31 NM:i:1
          HWUSI-EAS492:1:1:7:1783#ATCACG/2 147 9 88891047 255 36M = 88890976 -107 CAAAAGGGTATACTCAACAAAACTGGAAAACCTGGA B_
          a`_NF[[^\]QTO^_Z\aa]ZXUT_a`Z]a\_aa XA:i:0 MD:Z:36 NM:i:0


          To me, this output looks fine. So the question remains, why the discrepancy? Does the -m tag affect something in the alignment that I'm not aware of?

          Incidentally, I also tried to run the original 1000 reads using the -y tag. This had no great impact.

          Comment

          • Xi Wang
            Senior Member
            • Oct 2009
            • 317

            #6
            It seems that some repeat sequences such as "TGTGTGTGTGTGTGTGGTATGTGTGTATGTGTGTGT" cause this problem. As the criteria for align PE sequences may be different from those for SE sequences.
            What would the results be if you map only half of the PE sequences?
            Last edited by Xi Wang; 12-18-2009, 08:59 AM.
            Xi Wang

            Comment

            • lh3
              Senior Member
              • Feb 2008
              • 686

              #7
              Another experiment that may help to understand the result is to try a more accurate aligner, for example, novoalign.

              Comment

              • gwilson
                Junior Member
                • Dec 2009
                • 5

                #8
                I've put the test data read 1 and read 2 through Bowtie seperately, treating it as single-end. This time the output is as you would expect i.e. the same number fail to align regardless of -m. Hence it only seems to be an issue affecting paired end data.

                The single end output is below (-m 1):
                bowtie -solexa1.3quals ref_genome -p 4 -m 1 test2
                # reads processed: 1000
                # reads with at least one reported alignment: 526 (52.60%)
                # reads that failed to align: 72 (7.20%)
                # reads with alignments suppressed due to -m: 402 (40.20%)
                Reported 526 alignments to 1 output stream(s)

                and default -m

                bowtie -solexa1.3quals ref_genome -p 4 test2
                # reads processed: 1000
                # reads with at least one reported alignment: 928 (92.80%)
                # reads that failed to align: 72 (7.20%)
                Reported 928 alignments to 1 output stream(s)


                Has anyone else seen this issue with paired end data?

                Comment

                • Xi Wang
                  Senior Member
                  • Oct 2009
                  • 317

                  #9
                  I think we should make the definition of "meads with alignments suppressed due to -m" and the definition of "reads that failed to align" clear.
                  Xi Wang

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                    by SEQadmin2






                    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                    Despite this, “CRISPR helped turn genome editing from a specialized
                    ...
                    07-31-2026, 11:01 AM
                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM
                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    07-09-2026, 11:10 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 07-31-2026, 02:55 AM
                  0 responses
                  20 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-24-2026, 12:17 PM
                  0 responses
                  16 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-23-2026, 11:41 AM
                  0 responses
                  16 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-20-2026, 11:10 AM
                  0 responses
                  26 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...