Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Samtool error

    Hi All,
    I am getting following error with SAMtools while converting .sam file to .bam file.
    samtools view -bt hg19.fa Input.sam -o Output.bam
    Parse error at line 103686571: sequence and quality are inconsistent
    Is there any easy to fix this issue (i.e., remove the sequence lines that are not consistent with quality values)?
    Thanks for your help,
    Hemang

  • #2
    Probably worthwhile to figure out why you're getting that problem in the first place. Can you copy and paste the read(s) that are causing the error? What sequencing platform are you using?

    Comment


    • #3
      Thanks for looking into it. We are using Illumina platform to generate data. I have used several packages (i.e., BWA, asSeq in R and samtools) so basically some of the reads were trimmed. Is there any easy to fix this issue (i.e., remove the sequence lines that are not consistent with quality values)? Here is the read that is causing the error:

      HWI-ST165_0195:6:68:21171:200547#0 77 * 0 0 * * 0 0 CACCTATTCATACTCGTGCTCTGGCTCGGCAATCACCTGTAGCAGCAAAAACAAAGAGGGTGAGGCCTTCATT HHHHHHHHHHHHHHHHHHFDDDGFEFDHFHHED>HFD<C>7A>?A@EEAE2+9:1+&(%68<<@=CDEEE?AD RG:Z:111_N_R

      Thanks for your help,

      Hemang

      Comment


      • #4
        I think it might just be your command as I took that read and aligned it/converted it to a bam file without problems.

        Maybe try the following if you also want to sort the file:

        Code:
        samtools view -uS Input.sam | samtools sort - Input_sorted
        Otherwise try:

        Code:
        samtools view -bS Input.sam -o Output.bam

        Comment


        • #5
          Thank you so much for your help. It worked perfectly fine.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Advanced Tools Transforming the Field of Cytogenomics
            by seqadmin


            At the intersection of cytogenetics and genomics lies the exciting field of cytogenomics. It focuses on studying chromosomes at a molecular scale, involving techniques that analyze either the whole genome or particular DNA sequences to examine variations in structure and behavior at the chromosomal or subchromosomal level. By integrating cytogenetic techniques with genomic analysis, researchers can effectively investigate chromosomal abnormalities related to diseases, particularly...
            Yesterday, 06:26 AM
          • seqadmin
            How RNA-Seq is Transforming Cancer Studies
            by seqadmin



            Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...
            09-07-2023, 11:15 PM
          • seqadmin
            Methods for Investigating the Transcriptome
            by seqadmin




            Ribonucleic acid (RNA) represents a range of diverse molecules that play a crucial role in many cellular processes. From serving as a protein template to regulating genes, the complex processes involving RNA make it a focal point of study for many scientists. This article will spotlight various methods scientists have developed to investigate different RNA subtypes and the broader transcriptome.

            Whole Transcriptome RNA-seq
            Whole transcriptome sequencing...
            08-31-2023, 11:07 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Today, 06:57 AM
          0 responses
          6 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, Yesterday, 07:53 AM
          0 responses
          8 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 09-25-2023, 07:42 AM
          0 responses
          14 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 09-22-2023, 09:05 AM
          0 responses
          44 views
          0 likes
          Last Post seqadmin  
          Working...
          X