Viral Alignment- ViralFusionSeq

[eligar97]

Hi everyone. I am a high school intern and I am working in aligning viral genomes to RNAseq data. I am very new to bioinformatics, and am still learning how to manage alignment software. I have been using the software ViralFusionSeq to locate viral integration sites. Unfortunately, I am having major technical difficulties. I am constantly getting the same error message when I try to run the sample dataset. I have installed all of the cpan modules and 3rd party software, but I still get this error:

Thread 1 terminated abnormally: main=HASH(0x2b212422a238) at viral.fusion.pl line 621.
Thread 2 terminated abnormally: main=HASH(0x2b212822a240) at viral.fusion.pl line 622.
Use of uninitialized value $ReturnData[0] in join or string at viral.fusion.pl
line 624 (#1)
(W uninitialized) An undefined value was used as if it were already
defined. It was interpreted as a "" or a 0, but maybe it was a mistake.
To suppress this warning assign a defined value to your variables.

To help you figure out what was undefined, perl will try to tell you the
name of the variable (if any) that was undefined. In some cases it cannot
do this, so it also tells you what operation you used the undefined value
in. Note, however, that perl optimizes your program and the operation
displayed in the warning may not necessarily appear literally in your
program. For example, "that $foo" is usually optimized into "that "
. $foo, and the warning will refer to the concatenation (.) operator,
even though there is no . in your program.

Use of uninitialized value $ReturnData2[0] in join or string at viral.fusion.pl
line 627 (#1)

Does anyone who has used this software have any ideas as to why I have this error?

Thanks for your help.

[marcowanger]

Hi eligar97,

Which version fo VFS did you download?

Are you running VFS on Ubuntu system, or others?

Marco

[eligar97]

I'm using the December 7th, 2012 version. Its being run on Ubuntu.

[marcowanger]

Hi eli, did the single thread version of VFS works?

[akhattri]

hi there, I am also getting somewhat similar error while running VFS (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.

[COLOR="Teal"][B][SIZE="4"]Command[/SIZE][/B][/COLOR]
perl 2.run.example.dataset.pl

[FONT="Times New Roman"][B]The file "2.run.example.dataset.pl" has a the following command:[/B][/FONT]
perl viral.fusion.pl --config vfs.conf --insertSIZE 350 HKCI5a CL7R_1_VFS.fq CL7R_2_VFS.fq

[FONT="Times New Roman"][B]Both the fq files are included in vfs and I edited vfs.conf file to include the path of 3rd party software[/B].[/FONT]


[COLOR="Teal"][B][SIZE="4"]Error 1[/SIZE][/B][/COLOR]
Hashing CL7R_1_VFS.dynamic.min35.fq.gz
Hashing CL7R_2_VFS.dynamic.min35.fq.gz
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/RPmethod.pm line 268 (#1)
    (W uninitialized) An undefined value was used as if it were already
    defined.  It was interpreted as a "" or a 0, but maybe it was a mistake.
    To suppress this warning assign a defined value to your variables.
    
    To help you figure out what was undefined, perl tells you what operation
    you used the undefined value in.  Note, however, that perl optimizes your
    program and the operation displayed in the warning may not necessarily
    appear literally in your program.  For example, "that $foo" is
    usually optimized into "that " . $foo, and the warning will refer to
    the concatenation (.) operator, even though there is no . in your
    program.
    
Hashing vfs_dev.HKCI5a.4h_map.fq
Entering Essential::tx_targeted_assembly.
Skipped Insert Size estimation. Supplied insert size: 350
Essential::ssake_reads_prep
Assuming fasta file
Hashing vfs_dev.HKCI5a.RPm.out_2.fa
Processing vfs_dev.HKCI5a.RPm.out_1.fa and vfs_dev.HKCI5a.RPm.out_2.fa
Use of uninitialized value in pattern match (m//) at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 2 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 2 (#1)
Use of uninitialized value in pattern match (m//) at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 4 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 4 (#1)
 

[FONT="Times New Roman"][B] --------------continued to even no of lines (6,8,10,12,14...36)--------------[/B][/FONT]

	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 38 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 38 (#1)



[COLOR="Teal"][B][SIZE="4"]Error 2: SSAKE[/SIZE][/B][/COLOR]

Running: /data3/users/arun/Apps/ssake_v3-8/SSAKE [v3.8]
-f vfs_dev.HKCI5a.RPm.plus.vicinity.CS_FnR.ssake.in
-s vfs_dev.HKCI5a.CSm.out.fullread.fa
	-i 0
-h 0
-w 1
-m 20
-o 3
-r 0.9
-t 0
-z 100
-p 1
-e 0.75
-k 4
-a 0.5
-x 20
Unpaired reads (optional) -g no-g
Scaffolds: vfs_dev.HKCI5a.targeted.assembly.sensitive.scaffolds
Merged contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.mergedcontigs
Pairing issues: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_issues
Pairing distance distribution: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_distribution.csv

Contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.contigs
Singlets: vfs_dev.HKCI5a.targeted.assembly.sensitive.singlets

Excluded reads: vfs_dev.HKCI5a.targeted.assembly.sensitive.short
Log: vfs_dev.HKCI5a.targeted.assembly.sensitive.log

=>Reading sequences initiated Thu Jan  2 14:45:44 CST 2014
Sequence reads loaded:
616Input error at line #618: The sequence "0:" is not in the right format for paired-end reads  -- Fatal
Make sure your input is in the form (input sequences can be of variable lengths):

>test
GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT

Where : separates paired reads.  Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.
mv: cannot stat `vfs_dev.HKCI5a_temp/*.targeted.*.contigs': No such file or directory
Number of log files deleted:  0

[swbarnes2]

Why don't you start by including a snippet from your input files, and the exact command line you used.

[akhattri]

hi there, As swbarnes2 said, I've included the command ,in my question above , that I used to run vfs.
I used the same test files provided with the software (vfs), hence, I've not included the snippets.

Let me know if you need any other information.

Thanks

[marcowanger]

akhattri, I am looking at your problem now.

hi there, As swbarnes2 said, I've included the command ,in my question above , that I used to run vfs.
I used the same test files provided with the software (vfs), hence, I've not included the snippets.

Let me know if you need any other information.

Thanks

[IBseq]

hi everyone,
hope I'm in the right place!

I need to use vfs to detect fusions in my sequenced samples.

I am a very beginner on unix, thus im havng problems to get started:
I have downloaded vfs version 1289
I have downloaded all third party programs and hopefully everything i need to run it...

but!
I seem i might have missed the perl script to run the program...

any help?

thanks,
ib

[marcowanger]

Dear IBseq,

First you need to run 1.VFS.sys.check.pl to see if the dependencies can be called successfully. If you have already done that, then it is nice.

Then you either run viral.fusion.pl with your config file, or "2.run.example.dataset.pl" to test VFS on the example data supplied with the package.

Hope it helps.

Marco

[IBseq]

Dear IBseq,

First you need to run 1.VFS.sys.check.pl to see if the dependencies can be called successfully. If you have already done that, then it is nice.

Then you either run viral.fusion.pl with your config file, or "2.run.example.dataset.pl" to test VFS on the example data supplied with the package.

Hope it helps.

Marco

Thanks Marco,
I have run 1.VFS.sys.check.pl but where can I see the output?
No error came up, so shall I assume everything is correctly installed with correct dependencies?

Thanks very much,
ib

[IBseq]

Hello everyone,
quick question about vfs: to save my viral genome of interest, is is enough to use the fasta file from NCBI website (http://www.ncbi.nlm.nih.gov/nuccore/...9?report=fasta) and replace it with the hbv4.fa? i have noticed that the viral genome that comes with the package is different..

any suggestion?
thanks,
ib

[IBseq]

I meant different as it contains different lines. Not sure if this is specific with the hbv4 genome (which i dont know much about!)

[IBseq]

vfs running

hi everyone
(if anyone is there!!!)

I run the vfs example 1.VFS.sys.check.pl and got nothing. this is the report after i submitted the job:

Make sure BWA is installed and is available in PATH
List::Util qw( min max ) loaded: OK
Bio:B::Sam loaded: OK
Bio::SeqIO loaded: OK
Bio::SearchIO loaded: OK
Bio:B::Sam loaded: OK
AppConfig fails loading.
AppConfig::Getopt fails loading.
Cwd loaded: OK
Exporter loaded: OK
File::Which fails loading.
FileHandle loaded: OK
FindBin loaded: OK
Pod::Usage loaded: OK
Statistics:escriptive loaded: OK
File::Copy loaded: OK
PerlIO::gzip fails loading.
Please check AppConfig is installed properly
Please check AppConfig::Getopt is installed properly
Please check File::Which is installed properly
Please check PerlIO::gzip is installed properly


please any help!!!!

thanks,
ib