Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • milo0615
    replied
    Hi koustavpal,

    Thank you for the quick reply. I am currently aligning two de novo plant genomes (wild and domesticated genomes) and I am using a related plant genome as reference. My goal is to analyse the genetic diversity and differentiation within and between the domesticated and wild plant. I have already completed the alignment using LASTZ and combined the MAF alignments using MULTIZ but I am confused on what would be my next step. What would you recommend? Should I continue with the LASTZ pipeline or do you have a better method in mind? I would really appreciate your help.


    Regards,

    -Milo

    Originally posted by koustavpal View Post
    Hi milo,

    I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

    Maybe you can start there if you haven't already.

    On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.

    Leave a comment:


  • koustavpal
    replied
    Hi milo,

    I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

    Maybe you can start there if you haven't already.

    On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.

    Leave a comment:


  • milo0615
    replied
    Hi koustavpal,

    Were you able to figure it out? What was causing the problem? what Phastcons command did you use? I am in the same situation. Please let me know.


    thank you,

    -Milo

    Originally posted by koustavpal View Post
    i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

    a score=21045.000000
    s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
    s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

    I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

    a score=21045.000000
    s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
    s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

    and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

    and this problem is common in all files where i have made this change
    it would be really helpful if someone can point out the problem here.

    the multiz command i use is

    multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


    and the command i used to change them was:

    awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2

    Leave a comment:


  • koustavpal
    replied
    bump

    not to spam or anything but i really need help on this. so bump!

    Leave a comment:


  • koustavpal
    started a topic problem running multiz with MAF files

    problem running multiz with MAF files

    i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

    a score=21045.000000
    s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
    s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

    I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

    a score=21045.000000
    s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
    s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

    and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

    and this problem is common in all files where i have made this change
    it would be really helpful if someone can point out the problem here.

    the multiz command i use is

    multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


    and the command i used to change them was:

    awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-21-2024, 07:49 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-20-2024, 07:23 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-17-2024, 06:54 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
25 views
0 likes
Last Post seqadmin  
Working...
X