problem running multiz with MAF files

[milo0615]

Hi koustavpal,

Thank you for the quick reply. I am currently aligning two de novo plant genomes (wild and domesticated genomes) and I am using a related plant genome as reference. My goal is to analyse the genetic diversity and differentiation within and between the domesticated and wild plant. I have already completed the alignment using LASTZ and combined the MAF alignments using MULTIZ but I am confused on what would be my next step. What would you recommend? Should I continue with the LASTZ pipeline or do you have a better method in mind? I would really appreciate your help.


Regards,

-Milo

Hi milo,

I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

Maybe you can start there if you haven't already.

On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.

[koustavpal]

Hi milo,

I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

Maybe you can start there if you haven't already.

On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.

[milo0615]

Hi koustavpal,

Were you able to figure it out? What was causing the problem? what Phastcons command did you use? I am in the same situation. Please let me know.


thank you,

-Milo

i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

a score=21045.000000
s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

a score=21045.000000
s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

and this problem is common in all files where i have made this change
it would be really helpful if someone can point out the problem here.

the multiz command i use is

multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


and the command i used to change them was:

awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2

[koustavpal]

bump

not to spam or anything but i really need help on this. so bump!

[koustavpal]

i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

a score=21045.000000
s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

a score=21045.000000
s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

and this problem is common in all files where i have made this change
it would be really helpful if someone can point out the problem here.

the multiz command i use is

multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


and the command i used to change them was:

awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2