Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • scondo
    Junior Member
    • Feb 2013
    • 6

    Samtools mpileup for Solid Data - calls wrong and too less SNP/INDELS

    Hello,

    i simulated SOLiD-PE Reads with dwgsim and use BWA (0.5-Version) for mapping in Colorspace. When use the mpileup command from Samtools i got no ja wrong and strange output. I use the same Bamfile for other callers like freebayes or gatk and there i got my expected results (round about 18000 Indels/SNP in EXOM)

    I added CS:Z: and CQ:Z: tag and READ-Groups to my samfile because GATK_BQSR need it and it works well. So i think this should not be the problem.

    Here are my Inputs:
    SAM-file TEST_SOLID_5x_header.sam:
    ....
    @SQ SN:chr21 LN:48129895
    @SQ SN:chr22 LN:51304566
    @SQ SN:chrX LN:155270560
    @SQ SN:chrY LN:59373566
    @RG ID:five_fold_test PL:solid PU:test_unit LB:solid_test SM:five_fold_test
    @PG ID:bwa PN:bwa VN:0.5.9-r26-dev
    chr1_110292753_110292997_0_1_0_0_0:0:0_1:0:0_0 97 chr1 110292780 37 73M = 110293024 277 TTTGGGAAAGAGGTAAAATAAATAGGTGGTTACTGGGGAGGCTCCAACACAGCCAGAAGGGACACTGTTTGCT ]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]WY]]]]T]]]]]Z]]]L//////////// RG:Z:five_fold_test XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:73 CS:Z:A210010020022201300033003320110103121000220322010111123012202002111211001320 CQ:Z:FGHFGHHEGGEGGFHBGHBHHH?HHFHBHGFFEHGGCECBADBAC+EDC=74E>AD:7A5@##############

    -> convert to Bam-file -> Sort -> Index

    Samtools mpileup:

    samtools mpileup -uf unmutiert_ucsc_chr1-22XY.cs.fa TEST_SOLID_5x_header_sorted.bam | bcftools view -bvcg - > var.raw.bcf

    I got a breakdown:
    [mpileup] 1 samples in 1 input files
    <mpileup> Set max per-file depth to 8000
    [afs] 0:2107.299 1:27.577 2:29.124

    I expect round about 18000 vcf-entries and samtools call 45_ Example:
    chr1 36931497 . gga g 7.57 . INDEL;DP=3;VDB=0.0295;AF1=0.5336;CI95=0.5,1;DP4=1,0,1,1;MQ=24;FQ=-25.5;PV4=1,0.13,1,0.2 GT:PL:GQ 0/1:44,0,9:13
    chr1 197093832 . tacaca taca 14.4 . INDEL;DP=2;VDB=0.0588;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=29;FQ=-40.5 GT:PL:GQ 1/1:53,6,0:10
    chr1 205131047 . tata t 19.3 . INDEL;DP=2;VDB=0.059

    Any suggestions?

    Best regards
  • westerman
    Rick Westerman
    • Jun 2008
    • 1104

    #2
    I suspect that BWA is not handling colorspace correctly. You'll notice that they dropped support for it in the most recent versions. While I am not sure about the following, I suspect that what they are outputting is the so-called "double-encoded" version of color space where the colorspace 0=A, 1=C and so on. If so this would obviously make any SNP calling go haywire unless you are using a double-encoded reference in Samtools. Even then I am not sure if you would get good results.

    As I said I could be wrong about the above. But I do suggest using more recent tools that are made to work with native colorspace.

    Comment

    • westerman
      Rick Westerman
      • Jun 2008
      • 1104

      #3
      Also, now that I look more closely, it appears that your reference file is 'unmutiert_ucsc_chr1-22XY.cs.fa'. What is the format of that file? Color-space? double-encoded? Something else?

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Today, 11:41 AM
      0 responses
      9 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      22 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      35 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      45 views
      0 reactions
      Last Post SEQadmin2  
      Working...